Bioradiations

按最大似然比的Combining Molecular Profiling Methods

Bioradiations Staff

Dive into an in-depth exploration of the molecular methods for gene expression profiling — highlighting the strengths, applications, and uses of quantitative PCR (qPCR), Droplet Digital PCR (ddPCR), and RNA sequencing (RNA-Seq) technologies.

The post按最大似然比的Combining Molecular Profiling Methodsfirst appeared onBioradiations.]]>

流动Cytometry and the Law of Bottlenecks

Bioradiations Staff

Manufacturing and high-throughput screening may seem to have very little in common, but they are related at a fundamental level. Both seek to transform a raw material into a finished product, and both struggle with constraints, or bottlenecks, that reduce efficiency. How can we apply the revolutionary 20th century management principles of continuous improvement to 21st century flow cytometry?

The post流动Cytometry and the Law of Bottlenecksfirst appeared onBioradiations.]]>

BioRad.io Podcast Series

Bioradiations Staff

The BioRad.io podcast series is focused on R&D informatics, introducing you to people responsible for implementing systems and technologies to a diverse set of use-cases. Join us every month to see what you can learn.

The postBioRad.io Podcast Seriesfirst appeared onBioradiations.]]>

Rising from the Ashes:The History of the 488nm Laser

Bioradiations Staff

Despite the pivotal role of the 488 nm (blue) laser in the rise in popularity of flow cytometry, it experienced somewhat of a fall from grace following the shift to higher usage of the 561 nm (yellow) laser. However, with the advancement of flow cytometry leading to the use of more complex multicolor panels and ever-increasing fluorophore numbers per experiment, the blue laser is starting to make a comeback. Discover how StarBright Blue Dyes can help you make the most out of your 488 nm laser.

The postRising from the Ashes:The History of the 488nm Laserfirst appeared onBioradiations.]]>

CHT Chromatography Media:5 Essential Facts

Bioradiations Staff

For over 30 years, CHT Ceramic Hydroxyapatite Chromatography Media has been a trusted, proven purification solution for many biopharmaceutical manufacturing processes. CHT Media provides exceptional removal of impurities when other chromatography resins fall short.
In this webcast, explore the essential facts and benefits of this chromatography technology.

The postCHT Chromatography Media:5 Essential Factsfirst appeared onBioradiations.]]>

PrimePCR Assays: Your Path to a Custom PCR Plate

Bioradiations Staff

Discover the simplicity of crafting your own custom PrimePCR plate with Bio-Rad. Follow along with our intuitive plate wizard, which helps you select your plate type (96- or 384-well) and compatible qPCR instrument for precise assay delivery. Watch this video to see how.

The postPrimePCR Assays: Your Path to a Custom PCR Platefirst appeared onBioradiations.]]>

Nature’s Lipid Nanoparticles: Challenges and Opportunities in Isolation and Analysis of Extracellular Vesicles

Bioradiations Staff

In nature, mammalian extracellular vesicles (EVs) are vital for intercellular communication, immune responses, and cell removal. EVs also hold promise in diagnostics, therapeutics, and vaccine delivery due to their abundance and natural role as carriers. Explore how overcoming challenges in EV purification and precise RNA analysis methods can help unlock their potential applications.

The postNature’s Lipid Nanoparticles: Challenges and Opportunities in Isolation and Analysis of Extracellular Vesiclesfirst appeared onBioradiations.]]>

Effective Strategies for Endotoxin Removal in Therapeutic Protein Purification

Bioradiations Staff

Endotoxins are common impurities that pose safety risks in therapeutic protein preparations and are difficult to remove. See proven workflows and strategies.

The postEffective Strategies for Endotoxin Removal in Therapeutic Protein Purificationfirst appeared onBioradiations.]]>

Guidance for the Validation of qPCR and ddPCR Assays in Regulated Environments

Bioradiations Staff

In this webinar, learn about validating qPCR and ddPCR assays in regulated environments. Explore validation parameters and regulatory considerations.

The postGuidance for the Validation of qPCR and ddPCR Assays in Regulated Environmentsfirst appeared onBioradiations.]]>

A Polishing Strategy for Removing Impurities in Bispecific Antibody Purification

Bioradiations Staff

Bispecific antibodies pose unique challenges in downstream processing. See how impurities were efficiently removed by mixed-mode chromatography in this webinar.

The postA Polishing Strategy for Removing Impurities in Bispecific Antibody Purificationfirst appeared onBioradiations.]]>

Replication-Competent Virus Testing: A Critical Step in Cell and Gene Therapy Quality Control

Bioradiations Staff

Scientists commonly use lentiviruses and adeno-associated viruses (AAVs) as viral vectors in cell and gene therapy (CGT) production. However, therapies that use these viruses must undergo strict quality control measures, including testing for replication-competent viruses (RCV), to ensure that the treatment is safe. Cell culture-based methods are currently the gold standard for RCV testing, but it can take up to 45 days for results to be returned. Droplet Digital PCR (ddPCR) kits now offer an attractive orthogonal method.

The postReplication-Competent Virus Testing: A Critical Step in Cell and Gene Therapy Quality Controlfirst appeared onBioradiations.]]>

CAR T-Cell Therapy and the Cytokine Storm: The Balancing Act at the Center of Next-Generation Cancer Therapies

Bioradiations Staff

Recent advances in chimeric antigen receptor (CAR) T-cell therapy have opened exciting new avenues for the treatment of a variety of malignancies. Cytokine release syndrome (CRS), a powerful immune response to activated CAR T cells, is the primary side effect of CAR T-cell therapy, but existing CRS treatments can make CAR T-cell treatment less effective. In two recent studies, researchers used multiplexed cytokine immunoassays to better understand how CAR T-cell therapy triggers CRS and to identify strategies for early intervention in CRS development.

The postCAR T-Cell Therapy and the Cytokine Storm: The Balancing Act at the Center of Next-Generation Cancer Therapiesfirst appeared onBioradiations.]]>

NalaGenetics Moves Pharmacogenomics from the Bench to the Clinic using qPCR: An Interview with Astrid Irwanto, Co-Founder and COO

Bioradiations Staff

Astrid Irwanto is the co-founder and COO of NalaGenetics, a company taking a novel, personalized approach to understanding genetic susceptibility to drug reactions in Southeast Asian populations. A PhD in human genetics and postdoctoral research in genetics disease, along with personal experiences, fuel Astrid’s pursuits. In this interview, we discuss NalaGenetics’ approach to pharmacogenomics and why Astrid decided to translate her academic research to a molecular diagnostics company.

The postNalaGenetics Moves Pharmacogenomics from the Bench to the Clinic using qPCR: An Interview with Astrid Irwanto, Co-Founder and COOfirst appeared onBioradiations.]]>

Scalable AAV Vector Purification Workflow Using AEX and Mixed-Mode Chromatography

Bioradiations Staff

Anion exchange and mixed-mode chromatography offer efficient and flexible AAV purification. Learn new strategies for optimizing viral vector purification.

The postScalable AAV Vector Purification Workflow Using AEX and Mixed-Mode Chromatographyfirst appeared onBioradiations.]]>

StarBright Dyes for Flow Cytometry

Bioradiations Staff

Watch this video to learn about the many benefits of StarBright Dyes — our proprietary fluorescent nanoparticles — and see how they can help you build bigger, better flow cytometry panels with ease. StarBright Dyes have been designed to be stable, with superior brightness, narrow excitation and emission characteristics, and the flexibility to be included in new and existing experiments. They offer improved resolution of specific cell populations and minimized spillover and spreading.

The postStarBright Dyes for Flow Cytometryfirst appeared onBioradiations.]]>

Developing Biotherapeutics for Lung Cancer Treatment

Bioradiations Staff

In recent years, biologics — drugs derived from living culture systems — have become increasingly significant in the fight against a plethora of conditions. Unfortunately, the efficiency of these drugs comes at a cost. A daily dose of a biologic drug costs, on average, 22 times more than conventional small-molecule drugs. Therefore, biosimilars are developed to make them more accessible. Lung cancer is an example where the development of biosimilars could increase treatment options available for patients.

The postDeveloping Biotherapeutics for Lung Cancer Treatmentfirst appeared onBioradiations.]]>

Enhancing the Power of Microsatellite Instability Detection with ddPCR Technology

Bioradiations Staff

As the third most prevalent cancer worldwide, colorectal cancer (CRC) is a significant global health burden. Biomarker identification and detection has proven a powerful strategy for improving CRC diagnosis and informing targeted treatment. Microsatellite instability (MSI) is a key biomarker in CRC, and with Droplet Digital PCR (ddPCR), MSI can be accurately detected using a wider range of sample types.

The postEnhancing the Power of Microsatellite Instability Detection with ddPCR Technologyfirst appeared onBioradiations.]]>

7 Ways Custom PCR Reagents and Plastics Fuel Product Development

Bioradiations Staff

One-size-fits-all solutions cannot address the full range of molecular biology needs in areas such as biotech, biopharma, or molecular diagnostics. When your requirements exceed the existing offerings of reagents and plastics on the market, Bio-Rad can partner with you and provide custom solutions. For a deeper look into these customization opportunities, we spoke with Anna Lai, manager of Bio-Rad's custom reagents program, and Jennifer Placek, who manages the company's custom plastics.

The post7 Ways Custom PCR Reagents and Plastics Fuel Product Developmentfirst appeared onBioradiations.]]>

Sequenced — Comic Series

Bioradiations Staff

Join Terence, a motivated undergrad, as he experiences the ups and downs of research using next-generation sequencing, learning valuable tips for successful NGS experiments along the way

The postSequenced — Comic Seriesfirst appeared onBioradiations.]]>

Automated Multicolumn Monoclonal Antibody Purification

Bioradiations Staff

The current gold standard in monoclonal antibody purification for most researchers is affinity purification with Protein A or G followed by size exclusion chromatography (SEC). Although robust and highly effective, this workflow does have critical pain points and inefficiencies, leaving researchers to feel that they must oversee every step of their workflow, not leaving their chromatography system unattended for more than a few minutes.

The postAutomated Multicolumn Monoclonal Antibody Purificationfirst appeared onBioradiations.]]>

Did You Know That Beyond Sensitivity, ddPCR Provides Unrivaled Precision and Accuracy?

Bioradiations Staff

Methods that are highly accurate and precise provide the right answer, consistently. For digital PCR (dPCR), Poisson statistics dictate that the accuracy and precision of results are dependent on the accuracy and precision of sample partitions. This means that to get reliable dPCR results, you need to know your partition volume accurately and your partition volumes need to be consistent. See how our Droplet Digital PCR technology provides both accuracy and precision.

The postDid You Know That Beyond Sensitivity, ddPCR Provides Unrivaled Precision and Accuracy?first appeared onBioradiations.]]>

The Pioneer Antibody Discovery Platform: Clinical-Quality Lead Candidates in Industry-Leading Timelines

Bioradiations Staff

Biotherapeutic antibody discovery is inherently challenging. Amongst the clinically proven technologies for antibody discovery is phage display — a technique utilized by one of the most recent and innovative solutions on the market: the Pioneer Antibody Discovery Platform.

The postThe Pioneer Antibody Discovery Platform: Clinical-Quality Lead Candidates in Industry-Leading Timelinesfirst appeared onBioradiations.]]>

Efficacy of a Novel Treatment for Multiple Myeloma Established by Flow Cytometry

Bioradiations Staff

Autologous stem cell transplantation (ASCT) is an effective treatment strategy for multiple myeloma (MM) but isolating enough hematopoietic stem and progenitor cells (HSPCs) for transplantation can be challenging. The selective CXCR4 inhibitor motixafortide has been shown to be a safe and efficacious HSPC mobilization agent in a phase 2 trial when paired with G-CSF. Crees et al. (2023) report the results of the phase 3 trial, in which they used the ZE5 Cell Analyzer to explore motixafortide’s mobilizing effects.

The postEfficacy of a Novel Treatment for Multiple Myeloma Established by Flow Cytometryfirst appeared onBioradiations.]]>

Explore the Epigenomic Landscape of Single Cells with the scATAC You Seq

Bioradiations Staff

Gain access to high-performance chromatin profiling to unravel the complexities of cellular heterogeneity, differentiation, and disease-specific alterations in gene regulation. With single-cell ATAC-seq (assay for transposase-accessible chromatin using sequencing), you can delve into the gene regulatory landscape of individual cells, unlocking invaluable insights into the epigenomic mechanisms that shape their behavior.

The postExplore the Epigenomic Landscape of Single Cells with the scATAC You Seqfirst appeared onBioradiations.]]>

mAb Purification Process Development Using Mixed-Mode Resins — The DOE Approach

Bioradiations Staff

In this case study, process chromatography application scientist Artur Stanczak presents a two-step mAb purification workflow, comparing multimodal resin alternatives used for the polishing step that occurs after protein A capture. The design of experiment (DOE) data presented characterizes the behavior of multiple mAbs with two different mixed-mode resins. The importance of scale, prior knowledge, and the stage of development will also be discussed. The results of both mixed-mode resin studies and the different DOE approaches demonstrate the ability to achieve high-purity products.

The postmAb Purification Process Development Using Mixed-Mode Resins — The DOE Approachfirst appeared onBioradiations.]]>

Revolutionizing Efficacy and Safety Studies by Combining Organ-on-Chip Technology with xMAP-Based Bio-Plex Immunoassays

Bioradiations Staff

Discover how researchers are utilizing xMAP Multiplex Immunoassays to monitor biomarkers associated with tubular nephrotoxicity in kidney proximal tubule chips.

The postRevolutionizing Efficacy and Safety Studies by Combining Organ-on-Chip Technology with xMAP-Based Bio-Plex Immunoassaysfirst appeared onBioradiations.]]>

Mastering MIQE: How to Publish High-Quality qPCR Data

Bioradiations Staff

To obtain and publish the best quality qPCR data, you need to follow MIQE guidelines. See how to apply the MIQE guidelines to your experiments in this webinar.

The postMastering MIQE: How to Publish High-Quality qPCR Datafirst appeared onBioradiations.]]>

Deciphering Cancer Cell Heterogeneity for Precision Medicine

Bioradiations Staff

scATAC-seq is a powerful tool for studying cancer cell heterogeneity. Watch this webinar to see how scATAC-seq can deliver greater insights to your research.

The postDeciphering Cancer Cell Heterogeneity for Precision Medicinefirst appeared onBioradiations.]]>

Fundamentals of Real-Time PCR: The Aftershow

Bioradiations Staff

In this special webinar, the presenters of our Gene Expression University: Fundamentals of Real-Time PCR series answer frequently asked questions. Watch now.

The postFundamentals of Real-Time PCR: The Aftershowfirst appeared onBioradiations.]]>

Unraveling the Mysteries of Molecular Machines

Bioradiations Staff

Seychelle M. Vos, PhD, has a passion for science that was ignited at a young age while exploring her parents’ garden and the natural world around her. Now she studies some of the biggest questions in genome biology: how DNA structure and chromatin influence protein transcription. The molecular machines that physically couple transcription and DNA structure by changing the position of nucleosomes, interfacing with chromatin, and compressing DNA into loops, are the focus of Vos’ research.

The postUnraveling the Mysteries of Molecular Machinesfirst appeared onBioradiations.]]>

Poly(A) Tails: A Critical Quality Attribute in mRNA-based Therapeutics

Bioradiations Staff

The therapeutic potential of messenger RNA (mRNA) therapeutics has an unprecedented ability to target previously undruggable diseases. The poly(A) tail drives the therapeutic efficacy of the mRNA molecule. Using Droplet Digital PCR (ddPCR) technology to analyze poly(A) tail length and integrity yields unrivaled sensitivity, enabling developers to ensure high poly(A) tail integrity and, ultimately, functional therapeutic mRNAs.

The postPoly(A) Tails: A Critical Quality Attribute in mRNA-based Therapeuticsfirst appeared onBioradiations.]]>

PCR Plates: 5 Tips to Guide Your Buying Decision

Bioradiations Staff

Learn about 5 key aspects of a PCR plate that are crucial to your results. These tips provide you with the tools to make an informed decision when purchasing PCR plates.

The postPCR Plates: 5 Tips to Guide Your Buying Decisionfirst appeared onBioradiations.]]>

Introducing the PTC Tempo Thermal Cycler

Bioradiations Staff

The PTC Tempo Thermal Cycler represents the next generation of conventional PCR thermal cyclers from Bio-Rad. Engineered to maintain thermal performance, the PTC Tempo Thermal Cycler offers the flexibility to scale with your laboratory. The design features a refreshed, intuitive user interface and flexible connectivity options for streamlining protocol management. A motorized lid enables automation, taking your PCR to the next level with modern instrument control.

The postIntroducing the PTC Tempo Thermal Cyclerfirst appeared onBioradiations.]]>

Accurate Titering of Lentiviral Vectors is Paramount for Biotherapeutic Success

Bioradiations Staff

Lentiviral vectors (LVVs) have become the primary method of gene delivery for cells ex vivo in both academic and clinical applications. Currently, qPCR is the gold standard for functional titering of LVVs, but Droplet Digital PCR (ddPCR) offers an attractive alternative due to its inherent benefits, such as absolute quantification without the use of a standard curve and enhanced resistance to PCR inhibitors.

The postAccurate Titering of Lentiviral Vectors is Paramount for Biotherapeutic Successfirst appeared onBioradiations.]]>

内部Western:A Versatile Tool for Quantitative Analysis of Protein Expression In Situ

Bioradiations Staff

Protein expression analysis is essential in cell biology research，as it provides valuable insights into the molecular mechanism that underlie cellular functions.Traditional methods for protein analysis，such as western blotting and ELISA，are useful for studying protein expression in in in cell lysates.However， these methods require labor-intensive sample preparation and do not provide information on the spatial distribution of proteins within intact cells.In-Cell Western is a powerful technique that enables quantitative and qualitative in situ protein expression analysis。

The post内部Western:A Versatile Tool for Quantitative Analysis of Protein Expression In Situfirst appeared onBioradiations.]]>

Efficient and Rapid Purification of E. coli–Expressed Toxin Recombinant Protein Fragments

Bioradiations Staff

Tetanus toxoid (TT) is a common carrier protein for conjugate vaccines, but its production is faced with significant challenges. Learn about a purification process that yields over 98% pure target protein in this video.

The postEfficient and Rapid Purification ofE.coli–Expressed Toxin Recombinant Protein Fragmentsfirst appeared onBioradiations.]]>

Microphysiological Systems: A Game Changer for Drug Safety and Efficacy Studies?

Bioradiations Staff

In December 2022, a groundbreaking law was passed granting the U.S. FDA the authority to consider data from new alternative methods in the preclinical testing phase for new drug development. Among the new methods are 3D cell cultures that mimic human tissues and organs, known as microphysiological systems (MPS). The new law aims to improve clinical outcomes while decreasing reliance on animal testing. In this article, we discuss MPS and review data showing how they can synergize with Bio-Plex Assays.

The postMicrophysiological Systems: A Game Changer for Drug Safety and Efficacy Studies?first appeared onBioradiations.]]>

Next-Generation Chromatography Teaching Labs Set Students Up for Success

Bioradiations Staff

Dominique Ingato, PhD, is a faculty member at MiraCosta College’s Department of Biotechnology. As one of only fifteen community colleges in California to offer a bachelor’s degree, MiraCosta College’s bachelor’s program in biomanufacturing is breaking ground. As part of this program, Ingato runs a next-generation chromatography (NGC) teaching lab, where students receive practical, hands-on training using state-of-the-art instruments, such as the NGC Chromatography System.

The postNext-Generation Chromatography Teaching Labs Set Students Up for Successfirst appeared onBioradiations.]]>

How to Build Bigger Immunophenotyping Panels with Star Bright Dyes

Bioradiations Staff

With the advancement of technology, flow cytometers are now able to detect a much greater range of fluorescent dyes, facilitating the analysis of more extensive and complex multicolor immunophenotyping assays. But this has also introduced more pitfalls to navigate during the design of these experiments. Find out how StarBright Dyes can help circumvent many of these issues, enabling consistent and reliable results.

The postHow to Build Bigger Immunophenotyping Panels with StarBright Dyesfirst appeared onBioradiations.]]>

Achieving True Excellence in RNA Therapeutic Development

Bioradiations Staff

The realm of druggable targets has expanded significantly with the advent of mRNA therapeutics. Scientists require exceptional accuracy and confidence to adequately characterize these therapeutics and their anticipated effects. To this end, Droplet Digital PCR (ddPCR) technology has proven invaluable. With unparalleled precision and absolute quantification, Droplet Digital PCR is revolutionizing the field of mRNA therapeutic development and manufacturing.

The postAchieving True Excellence in RNA Therapeutic Developmentfirst appeared onBioradiations.]]>

Bridging the Gap: Using SEQuoia RNA-Seq Library Prep Kits with New Short-Read Sequencing Platforms

Bioradiations Staff

RNA sequencing (RNA-Seq) is a fundamental discovery technique for determining the expression patterns of encoded genes. RNA-Seq has led to innumerable breakthroughs across disciplines; however, a need remains for new sequencing and library preparation technologies to address gaps in current methods. Read how improved access to RNA-Seq would benefit translational research and how a novel RNA library preparation chemistry can synergize with new sequencing platforms.

The postBridging the Gap: Using SEQuoia RNA-Seq Library Prep Kits with New Short-Read Sequencing Platformsfirst appeared onBioradiations.]]>

Assessing Viral Clearance in Early-Phase Process Development

Bioradiations Staff

Viral clearance studies are part of a multifaceted approach to ensure biopharmaceutical product safety. To prevent costly changes to a manufacturing process, it is important to assess each operation unit for its efficiency early on during downstream process development. See how a design of experiments (DOE) approach was utilized in this case study to investigate the effect of buffer pH and conductivity on the removal of impurities by an anion exchange (AEX) mixed-mode chromatography resin.

The postAssessing Viral Clearance in Early-Phase Process Developmentfirst appeared onBioradiations.]]>

mAb Purification Process Development Using Mixed-Mode Resins — The DOE Approach

Bioradiations Staff

This webinar shows a 2-step mAb purification workflow and compares multimodal options for polishing. See how these methods can achieve high-purity products.

The postmAb Purification Process Development Using Mixed-Mode Resins — The DOE Approachfirst appeared onBioradiations.]]>

A Rapid, Culture-Free Method to Determine 50% Neutralization Titer (NT50) Using the ACE2-Competitive Bio-Plex Pro SARS-CoV-2 Neutralization Antibody Assay

Bioradiations Staff

In this webinar, see how a Bio-Plex Pro Assay could provide a high-throughput culture-free NT50 determination method for current and future SARS-CoV-2 variants.

The postA Rapid, Culture-Free Method to Determine 50% Neutralization Titer (NT50) Using the ACE2-Competitive Bio-Plex Pro SARS-CoV-2 Neutralization Antibody Assayfirst appeared onBioradiations.]]>

Genotype Screening in Songbirds Made Easy

Bioradiations Staff

Christien Bowman，MSc，has traversed a path from psychology to neuroscience，and is now working on attaining his PhD in biomedicine.In this interview， we discussed how Bowman uses Chelex100 Resin as part of a fast and cost-effective method to determine the sex of zebra finch songbirds.This work ultimatimately helps Bowman study a behavioral paradigm that creates autism-like features in songbirds。

The postGenotype Screening in Songbirds Made Easyfirst appeared onBioradiations.]]>

6 Key Considerations for Getting the Long and Short of RNA-Seq with FFPE Samples

Bioradiations Staff

When it comes to tumor profiling, the poor quality and degradation of RNA in formalin-fixed paraffin-embedded (FFPE) samples are major limitations. To overcome this challenge, we tested a novel RNA-Seq workflow using the SEQuoia Complete Library Prep Kit and the SEQuoia Ribodepletion Kit. This workflow offers more complex transcriptome profiling, including both long and short RNA biotypes, to better represent the complete transcriptome.

The post6 Key Considerations for Getting the Long and Short of RNA-Seq with FFPE Samplesfirst appeared onBioradiations.]]>

Flow Cytometry Empowers CAR T-Cell Therapies

Bioradiations Staff

Chimeric antigen receptor (CAR) T cells represent the next generation of therapeutic interventions and are a major advancement in personalized disease treatment. CAR T-cell therapies utilize a patient’s own T cells to recognize and destroy cancer cells or other disease-causing cells. Find out how the ZE5 Cell Analyzer has helped overcome some of the challenges associated with development of these powerful new therapies.

The postFlow Cytometry Empowers CAR T-Cell Therapiesfirst appeared onBioradiations.]]>

Scalable Purification Strategies for Viral Vectors and Vaccines

Bioradiations Staff

Large-scale downstream processing of viruses can face a range of obstacles different from those of many biotherapeutics. These challenges mostly arise from the size and complexity of the virus, which can affect product purity and recovery. Improvements of purification tools are necessary to overcome these challenges and must be engineered for easy scalability to meet manufacturing demands. In this video, Dr. Mark Snyder discusses common difficulties when developing purification strategies for vaccine production and gene therapy.

The postScalable Purification Strategies for Viral Vectors and Vaccinesfirst appeared onBioradiations.]]>

Maximizing Metastasis Insights with a Novel Integrated Workflow for CTC Enrichment and Enumeration

Bioradiations Staff

Watch this webinar to learn how a novel workflow can efficiently isolate CTCs for diverse downstream applications, without disrupting their native biology.

The postMaximizing Metastasis Insights with a Novel Integrated Workflow for CTC Enrichment and Enumerationfirst appeared onBioradiations.]]>

Generating Anti-CD19 CAR T Cells with High Efficiency and Viability via mRNA Electroporation

Bioradiations Staff

In this webinar, we describe an mRNA electroporation–based workflow for CAR T cell generation. See how high viability and transfection efficiency were achieved.

The postGenerating Anti-CD19 CAR T Cells with High Efficiency and Viability via mRNA Electroporationfirst appeared onBioradiations.]]>

Downstream Process Development for the Purification of Biosimilar Insulin from Escherichia coli

Bioradiations Staff

This webinar presents a downstream processing workflow for recombinant human insulin production from E. coli. Learn how proinsulin and insulin can be purified.

The postDownstream Process Development for the Purification of Biosimilar Insulin fromEscherichia colifirst appeared onBioradiations.]]>

Quick Tips for Western Blotting

Bioradiations Staff

Learn how to improve your western blotting results with our Quick Tips video series. Watch these 1–2 minute videos see how to perfect each step of the western blotting process.

The postQuick Tips for Western Blottingfirst appeared onBioradiations.]]>

Exploring Circulating Tumor DNA (ctDNA) as a New Oncology Clinical Trial Endpoint

Bioradiations Staff

Historically, five-year survival rates have been used to evaluate cancer therapeutic effectiveness in clinical trials. But time is critical for research — and for patients. Fortunately, there is a promising method for evaluating cancer therapeutic effectiveness that could potentially offer prognostic insights after just one year. Noninvasive liquid biopsy analysis, including analysis of circulating tumor DNA, is improving researchers’ ability to detect clinical responses more rapidly.

The postExploring Circulating Tumor DNA (ctDNA) as a New Oncology Clinical Trial Endpointfirst appeared onBioradiations.]]>

Solving Protein Purification Challenges

Bioradiations Staff

Carter Mitchell, PhD, is a protein problem solver. As Chief Science Officer at Kemp Proteins, he helps academic and industry researchers develop a range of protein therapeutics, diagnostics, and molecular tools in milligram to gram quantities with bioprocess scale in mind. In this interview, we discussed how Kemp Proteins ensures delivery of high-quality processes and protein-based products to their clients, even when working with difficult proteins.

The postSolving Protein Purification Challengesfirst appeared onBioradiations.]]>

Measure Neutralizing Antibodies against Any SARS-CoV-2 Variant in 1 Day

Bioradiations Staff

Current vaccines against severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) have reduced the severity of the coronavirus disease 2019 (COVID-19). However, the drastic and quick evolution of the virus poses challenges to the development of durable and efficacious therapeutics for vaccine and antibody developers alike. See how the Bio-Plex Pro Human SARS-CoV-2 Neutralization Antibody Custom Assay Developer Kit speeds up the qualitative measurement of neutralizing antibodies (NAbs) against new SARS-CoV-2 variants, removing a roadblock in COVID-19 therapeutic development.

The postMeasure Neutralizing Antibodies against Any SARS-CoV-2 Variant in 1 Dayfirst appeared onBioradiations.]]>

A Pioneering Approach to Biotherapeutic Antibody Discovery

Bioradiations Staff

Immunotherapy has revolutionized cancer treatment，yet the drug discovery process to develop new biotherapeutic antibodies remains arduous.However，significant advances in antibody technology such as phage display have enabled fully human antibodies to be developed franimal-free libries for jabogen。

The postA Pioneering Approach to Biotherapeutic Antibody Discoveryfirst appeared onBioradiations.]]>

Maximizing the Impact of Wastewater-Based Epidemiology with ddPCR Technology

Bioradiations Staff

As SARS-CoV-2 becomes an endemic agent worldwide, communities and health agencies must figure out how to identify novel variants and track infection rates in ways that are sustainable, sensitive, and accurate. Fortunately, wastewater-based epidemiology (WBE) has proven its ability to play an important role in monitoring COVID-19 outbreaks, and Droplet Digital PCR (ddPCR) has become a cornerstone method for ongoing wastewater-based disease surveillance. In this article, we review the role of wastewater-based testing in community health before, during, and beyond the COVID-19 pandemic, and we explore why ddPCR technology is ideally suited for this application as it continues to expand and evolve.

The postMaximizing the Impact of Wastewater-Based Epidemiology with ddPCR Technologyfirst appeared onBioradiations.]]>

Using ddPCR Technology to Improve Cancer Detection and Treatment Efficacy Monitoring

Bioradiations Staff

Cancer remains a leading cause of death worldwide. However, as cancer treatments continue to improve and diagnoses happen sooner, more and more patients are experiencing remission. To further increase survival rates and reduce unnecessary treatment, scientists and clinicians are turning to ultra-sensitive molecular analysis to inform treatment decisions and predict and detect relapse.

The postUsing ddPCR Technology to Improve Cancer Detection and Treatment Efficacy Monitoringfirst appeared onBioradiations.]]>

What You Need to Know About Packing Resins at Process Scale

Bioradiations Staff

Learn best practices and guidelines for successfully packing different types of chromatography resins in this video webinar. This includes incompressible resins, like CHT Ceramic Hydroxyapatite Media, as well as traditional compressible resins. In general, parameters such as compression factor, settling rate, and attributes of the base matrix need to be considered when packing resins at process scale. Packing methods can be adapted to obtain simple, highly reproducible packing. Get tips here.

The postWhat You Need to Know About Packing Resins at Process Scalefirst appeared onBioradiations.]]>

Quick Tips for Bio-Plex Assays

Bioradiations Staff

It is imperative to plan and prepare ahead of time for your research using Bio-Plex Assays to be successful. Good assay planning and preparation reduces mistakes and makes for a stress-free assay run. In this series of short videos, we share some simple steps you can take to make sure your work goes smoothly.

The postQuick Tips for Bio-Plex Assaysfirst appeared onBioradiations.]]>

Learn to Develop a New Multiplex SARS-CoV-2 Variant Neutralizing Antibody Assay in a Single Day

Bioradiations Staff

Develop new assays in just one day with the Bio-Plex Pro Human SARS-CoV-2 Neutralization Antibody Custom Assay Developer Kit. See how in this webinar.

The postLearn to Develop a New Multiplex SARS-CoV-2 Variant Neutralizing Antibody Assay in a Single Dayfirst appeared onBioradiations.]]>

Purification of DNA Oligonucleotides using Anion Exchange Chromatography

Bioradiations Staff

In this webcast, see how Nuvia HP-Q Resin, an anion exchange resin, was used to purify oligonucleotides with phosphodiester backbones in a scaleable workflow.

The postPurification of DNA Oligonucleotides using Anion Exchange Chromatographyfirst appeared onBioradiations.]]>

Connected Instruments in the Digital Laboratory

Bioradiations Staff

As technology advances, a digital transformation has begun in laboratories around the world. Driven by the need to improve data quality and increase the value derived from the investment in generating those data, data management systems, devices, and their workflows are becoming more connected and integrated, ushering in the age of the digital laboratory. The digital laboratory is one where paper lab notebooks are replaced with fully digital data, complete with rich metadata, and generated using integrated workflows. Such data are easy to find, reuse, and reproduce. Further digitization and workflow integration to operate laboratory instruments will advance the burgeoning digital laboratory.

The postConnected Instruments in the Digital Laboratoryfirst appeared onBioradiations.]]>

Single-Step Influenza Virus Purification Using an Anion Exchange Resin

Bioradiations Staff

A new and simplified anion exchange chromatographic process for the purification of both live and inactivated cell grown H1N1 influenza viruses was established with a recently developed anion exchanger. The resin is designed with an optimized surface extender and pore size for superior accessibility and large biomolecule binding capacity, aiming to overcome common drawbacks of existing ion exchangers for virus purification.

The postSingle-Step Influenza Virus Purification Using an Anion Exchange Resinfirst appeared onBioradiations.]]>

Leading the Way in Our Understanding of COVID-19: Peptide Megapool Assays

Bioradiations Staff

Understanding how T cells respond to severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is critical in developing long-term therapeutic approaches, as well as helping inform strategies for future pandemics. Learn how one team at the La Jolla Institute for Immunology in San Diego, California, has been using novel T-cell activation assays to understand how our immune system responds to SARS-CoV-2.

The postLeading the Way in Our Understanding of COVID-19: Peptide Megapool Assaysfirst appeared onBioradiations.]]>

Across the Blot:A Western Blotting Crossword

Bioradiations Staff

Do you think you know western blotting？Test your knowledge with a crossword puzzle。

The postAcross the Blot:A Western Blotting Crosswordfirst appeared onBioradiations.]]>

Precise Cell and Gene Therapy Potency Quantification

Bioradiations Staff

Inadequate quality control assays shouldn't limit cell and gene therapy applications. Instead, quantifying the potency of cell and gene therapies is essential for successful therapeutics. In this article, we describe multiple leading potency assays developed using Droplet Digital PCR (ddPCR) technology, including an assay that quantifies transgene integration and expression in one step.

The postPrecise Cell and Gene Therapy Potency Quantificationfirst appeared onBioradiations.]]>

The CFX Duet Real-Time PCR System: Our Most Accessible qPCR Technology

Bioradiations Staff

Through the CFX Duet Real-Time PCR System, our newest generation of quantitative PCR (qPCR) instrumentation, this technology is now even more accessible for molecular biologists and other professionals doing essential qPCR. With CFX Maestro Software, you can perform duplex detection, gene expression, and genotyping, all without paying for additional optics you don’t need. Check out our video tour of the new CFX Duet System.

The postThe CFX Duet Real-Time PCR System: Our Most Accessible qPCR Technologyfirst appeared onBioradiations.]]>

Modernizing Gene Editing Detection with Droplet Digital PCR

Bioradiations Staff

Gene editing is only useful if it’s successful. Read how scientists are leveraging the unparalleled accuracy and specificity of ddPCR technology to optimize quality control in gene editing projects, including HIV detection and CAR-T cell generation.

The postModernizing Gene Editing Detection with Droplet Digital PCRfirst appeared onBioradiations.]]>

Take the Expressway to RNA Library Prep

Bioradiations Staff

RNA-Seq library preparation is a manually intensive, time-consuming process prone to bias from the multiple enzymes required. So, how can you trust your sequencing results? Bio-Rad is revolutionizing RNA-Seq library prep with the SEQuoia Express Stranded RNA Library Prep Kit – a three-hour, three-tube solution eliminating the need for multiple enzymes and reducing both the number of pipetting steps and protocol time. The key is an engineered, proprietary retrotransposon called SEQzyme. With this serial template jumping, or continuous synthesis, reaction you can obtain an unbiased, stranded RNA-Seq library constructed to accurately represent both messenger and non-coding RNA from your sample.

The postTake the Expressway to RNA Library Prepfirst appeared onBioradiations.]]>

Multiplex SARS-CoV-2 Variant Neutralization Antibody Assays: Get Multiple Variant Results Fast

Bioradiations Staff

Bio-Plex Pro SARS-CoV-2 Neutralization Antibody Assays provide reliably measure neutralizing antibodies in less than 3 hours. Watch our webinar to learn more.

The postMultiplex SARS-CoV-2 Variant Neutralization Antibody Assays: Get Multiple Variant Results Fastfirst appeared onBioradiations.]]>

A Mixed-Mode Approach — An Alternative to a Three-Step mAb Purification Process

Bioradiations Staff

Monoclonal antibody (mAb) purification methods often involve the use of resin-based chromatography. In this video, we compare a three-step mAb purification workflow, which uses Nuvia Ion Exchange Resins post–Protein A capture, to a two-step purification workflow, which includes a Protein A capture step followed by a mixed-mode chromatography step using Nuvia aPrime 4A Resin, a hydrophobic anion exchange resin. We present an additional two-step purification approach using Protein A resin followed by a calcium affinity cation exchange media, CHT Ceramic Hydroxyapatite XT Media. The results of both studies demonstrate that a high purity product can be attained using one fewer unit operation than traditional workflows.

The postA Mixed-Mode Approach — An Alternative to a Three-Step mAb Purification Processfirst appeared onBioradiations.]]>

High Performance with GMP Ready CHT Prepacked Process-Scale Columns

Bioradiations Staff

Foresight Pro CHT Prepacked Columns are GMP ready for process-scale purification. Learn about the design and see performance data in this webinar.

The postHigh Performance with GMP Ready CHT Prepacked Process-Scale Columnsfirst appeared onBioradiations.]]>

Generation of Recombinant Tool Antibodies to Support Cell and Gene Therapy Development

Bioradiations Staff

Recombinant antibodies, CAR-T Cell Therapy Development, CAR-T Cell Therapy, Monoclonal Antibody Generation, custom antibodies, cell and gene therapy development, bioanalysis, biosimilar, immunogenicity, drug monitoring, antibody drug conjugate.

The postGeneration of Recombinant Tool Antibodies to Support Cell and Gene Therapy Developmentfirst appeared onBioradiations.]]>

Top 8 Advantages of Electroporation in Cell and Gene Therapy

Bioradiations Staff

Cell and gene therapies have seen record growth due to their potential to address the underlying causes of genetic and acquired diseases. Non-viral delivery methods are increasing in popularity due to their safety, cost-effectiveness, reduction in manufacturing time, and flexibility compared to viral vector delivery methods. Electroporation is a simple, broadly applicable method capable of delivering molecules to a wide range of cell types for either cell or gene therapy. This article outlines the top advantages of using electroporation in cell and gene therapy and why it might be a good approach for your own research group.

The postTop 8 Advantages of Electroporation in Cell and Gene Therapyfirst appeared onBioradiations.]]>

Unlocking the Power of Analysis with Automation

Bioradiations Staff

Disparate systems, distributed teams, and overly complex technologies are a recipe for inefficiency in research and development (R&D) laboratories, especially in drug development. With the pressure to meet challenging deadlines and strict regulations, it is easy for working practices to become disconnected. To improve the efficiency, accuracy, and consistency of data generation, acquisition, and management, R&D organizations are looking to streamline their lab practices by investing in technologies that automate data generation, accelerate data collection speed and storage, and enhance the quality and reliability of the information produced. Lab automation presents exciting opportunities for future research, promising novel advances in machine learning and artificial intelligence (AI), liquid handling robotics, and cloud-based data workflows.

The postUnlocking the Power of Analysis with Automationfirst appeared onBioradiations.]]>

Evaluating and Understanding the True Spread of COVID-19 through Seroprevalence

Bioradiations Staff

Circulation of SARS-CoV-2 in the global population led to the emergence of new variants threatening to undermine vaccine effectiveness. Understanding the immune response and its neutralizing abilities at both the patient level and globally could not only help prevent outbreaks but also mitigate the outcome for future pandemics.

The postEvaluating and Understanding the True Spread of COVID-19 through Seroprevalencefirst appeared onBioradiations.]]>

Trends in Wastewater-Based Epidemiology for 2022

Bioradiations Staff

Two years into the COVID-19 pandemic, trends point to a transition for the SARS-CoV-2 virus into an endemic agent. As major surveillance infrastructure scales back, it will be critical to maintain a cost-effective, simple, and rapid strategy for detecting and monitoring the spread of new variants. The key to such a strategy? Wastewater, where all disease agents leave their unique signature.

The postTrends in Wastewater-Based Epidemiology for 2022first appeared onBioradiations.]]>

Powering Antibody Production and Purification with the NGC Chromatography System

Bioradiations Staff

For this article, we spoke with Vera Dreyfuss of evitria AG, an antibody expression services provider based in Switzerland, about the role that the NGC Chromatography System has played in powering the growth and success of the company.

The postPowering Antibody Production and Purification with the NGC Chromatography Systemfirst appeared onBioradiations.]]>

The PI3K-AKT Pathway and Its Role in Tumorigenesis

Bioradiations Staff

The phosphoinositide 3-kinase/protein kinase B (PI3K-AKT) pathway is involved in the control of numerous critical cellular processes. PI3K-AKT pathway dysfunction has been observed in several diseases, including cancer, cardiovascular disease, and autoimmune and neurological disorders. In this animation, learn more about the molecular characteristics and function of the PI3K-AKT pathway and how AKT mutation plays a role in tumorigenesis.

The postThe PI3K-AKT Pathway and Its Role in Tumorigenesisfirst appeared onBioradiations.]]>

Wastewater SARS-CoV-2 Testing with Droplet Digital PCR (ddPCR) Technology

Bioradiations Staff

Wastewater-based epidemiology indirectly monitors infection rates in a community based on pathogen levels in local wastewater. Because symptomatic and asymptomatic SARS-CoV-2 infected individuals shed viral RNA in sewer systems, analysis of SARS-CoV-2 in sewage networks can provide information about SARS-CoV-2 infections within the community. However, the accuracy of these data depends on the quality of the wastewater testing method. During the COVID-19 pandemic, Droplet Digital PCR has proven that it has the sensitivity needed to detect outbreaks and monitor SARS-CoV-2 variants in communities via wastewater testing.

The postWastewater SARS-CoV-2 Testing with Droplet Digital PCR (ddPCR) Technologyfirst appeared onBioradiations.]]>

Manufacturing a Recombinant Retrovirus — Downstream Purification Process Development

Bioradiations Staff

Enveloped virus and VLP purification can be difficult. Learn about key factors and a cGMP-compatible, low cost, scalable process for retrovirus vector capture.

The postManufacturing a Recombinant Retrovirus — Downstream Purification Process Developmentfirst appeared onBioradiations.]]>

The ZE5 Cell Analyzer, a Fast and Flexible Flow Cytometer for High-Throughput Screening

Bioradiations Staff

High-throughput screening (HTS) is a critical component of the entire drug discovery process. Flow cytometry is an attractive alternative to imaging and plate reader assays for HTS in drug discovery, due to its increased sensitivity and multiplexing capabilities. The ZE5 Cell Analyzer eliminates pain points that have hindered the full adoption of flow cytometry for drug discovery.

The postThe ZE5 Cell Analyzer, a Fast and Flexible Flow Cytometer for High-Throughput Screeningfirst appeared onBioradiations.]]>

Scientists for Life:A Tale of Two Tattoos

Bioradiations Staff

ast scientists，no matter where they are at in their career，remember the moments of wonder as they navigated lab work for the first time.Whether it’s a band on a gel，a colony on a plate，or a piece of data，those first tangible results come with a feeling of having accomplished something increds，ithere in， we caught up with two scientists who immortalized that feeling in the form of matching protein ladder tattoos，and discussed howtheir time asundergraduate researchers led them where they are today。

The postScientists for Life:A Tale of Two Tattoosfirst appeared onBioradiations.]]>

Bispecific Antibodies and Cancer Immunotherapy

Bioradiations Staff

Bispecific antibodies（bsabs）are an important addition to the immuno-oncology toolbox。Designed to recognize two distinct epitopes，bsabs have enhanced binding，specificity，and efficy compared to current monoverent antibody therapeutics，making them exciting candidates formore targeted cancer treatments.Learn about bsabs and how our tools can help sciests with with reir theapather。

The postBispecific Antibodies and Cancer Immunotherapyfirst appeared onBioradiations.]]>

Monitoring CAR T-Cell Therapy Quality with Droplet Digital PCR

Bioradiations Staff

The CAR T-cell manufacturing process involves high potential for variability. Learn how sensitive ddPCR assays can be used to ensure safety and efficacy.

The postMonitoring CAR T-Cell Therapy Quality with Droplet Digital PCRfirst appeared onBioradiations.]]>

5 Reasons to Read the Antibody Advice Guide

Bioradiations Staff

In the day-to-day pressures of a research environment, it is natural to want to generate important data as quickly as possible. However, there are real benefits in ensuring that the antibody you have picked is the best for your experiment and spending time aliquoting and titrating your antibodies. Bio-Rad recently launched a free Antibody Advice Guide to equip scientists with the knowledge to get the best out of their experiments with antibodies. Read on for five examples of valuable information that you will learn from the guide, helping you generate publication-ready data.

The post5 Reasons to Read the Antibody Advice Guidefirst appeared onBioradiations.]]>

Viral RNA Preparation for Molecular Pathogen Detection:A New Application for Chelex 100 Resin and Instagene Matrix

Bioradiations Staff

Although vaccines have helped alleviate the negative impact of COVID-19, its persistence across many areas of the globe reveals a continuous need for rapid, accurate, and economical COVID-19 testing. But is it even possible to isolate and detect viral RNA rapidly and economically? Here we highlight a repurposed tool for improved COVID-19 detection: Chelex 100 Resin and the related InstaGene Matrix for rapid, cost-effective viral RNA preservation and detection.

The postViral RNA Preparation for Molecular Pathogen Detection:A New Application for Chelex 100 Resin and Instagene Matrixfirst appeared onBioradiations.]]>

The Process of Resin Screening

Bioradiations Staff

Process development scientists, faced with an increasing number of proteins or complex biomolecules, continuously search for robust purification methods that can be rapidly scaled for manufacturing. What are the optimal purification conditions for high throughput and yield? Which resin or resin combination best purifies the desired protein? How can an efficient, yet cost-effective process be established? The answer: use a systematic screening approach. Read on to learn more.

The postThe Process of Resin Screeningfirst appeared onBioradiations.]]>

Neutralizing Antibody Assays for SARS-CoV-2 Variant Studies

Bioradiations Staff

With COVID-19 vaccines now widely available, case numbers in many areas are falling. But the question remains: How long does vaccine-induced immunity last? Measuring isotype-specific antibodies against SARS-CoV-2 and the effectiveness of neutralizing antibodies against variants can help us better understand the duration and breadth of the humoral response. These data are critical to aid public health researchers and inform development decisions for vaccines and therapeutics. Read about the new Bio-Plex Pro Human SARS-CoV-2 Variant Neutralization Antibody 11-Plex Panel.

The postNeutralizing Antibody Assays for SARS-CoV-2 Variant Studiesfirst appeared onBioradiations.]]>

A Novel Technology for Post-Library rRNA Depletion

Bioradiations Staff

The SEQuoia RiboDepletion Kit employs novel technology to deplete ribosomal RNA while preserving rare transcripts and small RNAs, as well as minimizing the risk of degrading or low abundant samples. The SEQuoia RiboDepletion Kit also offers a streamlined workflow and multiplex compatibility, leading to significant time and cost savings compared to traditional methods. Watch this video to learn more.

The postA Novel Technology for Post-Library rRNA Depletionfirst appeared onBioradiations.]]>

Choosing Validated Antibodies for Trustworthy Data

Bioradiations Staff

The lack of reproducibility in research has been a source of frustration for scientists. Learn why antibody validation is critical for ensuring specificity and what validation methods Bio-Rad is implementing. Our scientists validate the performance of antibodies through CRISPR-Cas9 gene editing by knockout (KO), siRNA knockdown (KD), and immunoprecipitation followed by mass spectrometry (IP-MS).

The postChoosing Validated Antibodies for Trustworthy Datafirst appeared onBioradiations.]]>

A Scalable Immobilized Metal Affinity Chromatography Media for Process Purification

Bioradiations Staff

Downstream process purification of proteins requires a resin with optimized bead size for ideal pressure/flow properties and decent dynamic binding capacity (DBC) that provides production efficiencies and good process economics. Nuvia IMAC Resin provides the mechanical strength, pore structures, ligand density, and particle size distribution required for an operational run at 300 cm/hr with a DBC of 40 mg/ml at 2 bar column backpressure. Protein purification can efficiently be scaled up from milligrams in the lab to kilograms in bioprocess manufacturing. The chemical stability of Nuvia IMAC Resins ensure efficient column regeneration, reproducibility between purification runs, extended column lifetime, and product purity. Watch our video to learn how Nuvia IMAC Resins overcome the challenges associated with process purification of proteins using metal affinity chromatography.

The postA Scalable Immobilized Metal Affinity Chromatography Media for Process Purificationfirst appeared onBioradiations.]]>

Resolved-Comic Series

Bioradiations Staff

Follow along asanew starry-eyed graduate student learns the ins and outs of life asa research scientist，gaining valuable western blotting tips and tricks.Along for the ride are a seasoned postdoctoral fellow and traditional principal investigator。

The postResolved-Comic Seriesfirst appeared onBioradiations.]]>

5 High-Throughput Screening Applications Using Flow Cytometry

Bioradiations Staff

For many scientists, high-throughput flow cytometry screens are associated with drug or compound libraries, but did you know that you can also apply this technique to study microorganisms, clinical melanoma samples, and even protein trafficking? Read on for five examples of the use of flow cytometry in diverse, high-throughput screening applications.

The post5 High-Throughput Screening Applications Using Flow Cytometryfirst appeared onBioradiations.]]>

Beyond the Spec Sheet: Evaluating New qPCR Instrumentation

Bioradiations Staff

Whether you are part of a small academic lab or a multinational corporation, upgrading to a new quantitative PCR (qPCR) system can be both exciting and daunting. How will the new system perform compared to your current platform? Will your existing workflows translate smoothly? Read on to learn about our recent bridging study for users considering upgrading to the new CFX Opus Real-Time PCR System.

The postBeyond the Spec Sheet: Evaluating New qPCR Instrumentationfirst appeared onBioradiations.]]>

CDMOs Drive Cell and Gene Therapy from Behind the Scenes

Bioradiations Staff

As more of the cell and gene therapies revolutionizing healthcare are approved for use, innovator companies usually get the credit. But many therapies would never make it to market without the expertise and capabilities of contract development and manufacturing organizations (CDMOs) operating behind the scenes. Learn more about how CDMOs enable new cell and gene therapies to come to market, and how Droplet Digital PCR can help.

The postCDMOs Drive Cell and Gene Therapy from Behind the Scenesfirst appeared onBioradiations.]]>

启动启动启动系统

Bioradiations Staff

The next iteration of Bio-Rad Gel Documentation Systems has arrived.The GelDoc Go Imaging System gives you a benchtop imaging solution that enables gel documentation in three simple steps.Acquire high-resolution，publication-quality images of nucleic acid gels，protein gels， and colorimetric blots.Image up to four mini gels at once with the large imaging area，and easily set up and control the GelDoc Go Imaging System with Image Lab Touch Software.Read more about the compact，easy-to-use GelDoc Go System。

The post启动启动启动系统first appeared onBioradiations.]]>

Bioprocessing Recombinant Proteins

Bioradiations Staff

Infectious diseases and cancers are among the main causes of human deaths worldwide. One successful avenue found to treat these diseases is the large-scale production of therapeutic proteins. As a result, the demand for protein expression hosts and accompanying advanced bioprocessing technologies has increased. Read about a workflow for efficient purification of a low-expressing recombinant protein using mixed-mode resins.

The postBioprocessing Recombinant Proteinsfirst appeared onBioradiations.]]>

Two-Step Purification of Low-Expressing Recombinant Exoprotein A Using Mixed-Mode Chromatography

Bioradiations Staff

Purifying proteins that are not highly expressed can be challenging. Watch this video to learn about a case study demonstrating an efficient workflow for two-step purification of a low-expressing recombinant protein using mixed-mode chromatography.

The postTwo-Step Purification of Low-Expressing Recombinant Exoprotein A Using Mixed-Mode Chromatographyfirst appeared onBioradiations.]]>

Can You Find All the qPCR-Related Words？

Bioradiations Staff

Feeling stressed？Take a break with this qPCR-themed word search。

The postCan You Find All the qPCR-Related Words？first appeared onBioradiations.]]>

Top 5 Takeaways from ddPCR World 2021

Bioradiations Staff

Precision diagnostics for cancer. COVID-19 surveillance in wastewater. Quality control of cell and gene therapies. These were just a few of the cutting-edge applications on display at the Droplet Digital PCR (ddPCR) World 2021 symposium. Recapping the event in 5 takeaways, moderator Francisco Bizouarn shares how international experts are leveraging ddPCR technology to solve today’s scientific and public health problems.

The postTop 5 Takeaways from ddPCR World 2021first appeared onBioradiations.]]>

6 Tips to Secure Funding for Flow Cytometers

Bioradiations Staff

We asked core facilities staff and research scientists from the U.S. and Europe for their top tips for securing funding for large instrumentation, such as a cell analyzer or cell sorter. Here are the key questions you should consider while preparing your grant application to increase your chances of a successful outcome.

The post6 Tips to Secure Funding for Flow Cytometersfirst appeared onBioradiations.]]>

我的计算机辅助同步诊断程序

Bioradiations Staff

No patient who has survived cancer wants to hear that they’ve relapsed.But hearing it sooner rather than later can dramatically increase the chances of finding a successful，potentially life-saving treatment.Using next-generation sequencing and Droplet Digital PCR， researchers at the University of Uppsala aim to detect relapse by monitoring patient-specific biomarkers.Read about their ongoing clinical study。

The post我的计算机辅助同步诊断程序first appeared onBioradiations.]]>

Stain Free Western Blotting:Faster Results，Better Data

Bioradiations Staff

Western blotting is a well-accepted technique which has a place in every molecular biologist’s toolkit.However，the traditional process is lengthy and filled with manual steps， which can result in variability.Stain-Free technology can shorten your workflow and improve your data.Read our top three reasons to incorporate Stain-Free technology in your western blotting workflow。

The postStain Free Western Blotting:Faster Results，Better Datafirst appeared onBioradiations.]]>

Retain Rare Transcripts While Depleting Ribosomal RNA

Bioradiations Staff

Bio-Rad is excited to announce the launch of SEQuoia RiboDepletion Kit, the newest product in the SEQuoia portfolio of RNA-Seq sample preparation products. This is a stand-alone, post–library depletion kit that eliminates RNA-Seq library fragments that originated from ribosomal RNA sequences. The kit exhibits superior performance in retaining small RNAs while minimizing the loss of rare transcripts and RNA from limited samples, providing a better approach to whole transcriptome profiling. Furthermore, the cost of rRNA depletion can be significantly reduced by pooling and depleting multiple libraries in a single ribodepletion reaction.

The postRetain Rare Transcripts While Depleting Ribosomal RNAfirst appeared onBioradiations.]]>

高级Cancer Therapeutics:Increasing Efficacy and Specificity and Reducing Toxicity

Bioradiations Staff

Research into human diseases has led to the development of novel monoclonal antibody drugs.These monoclonal antibody therapies have been successful because of their specificity and selectivity.However，ongoing development and successfully launching anew mAb drug require robust and reliable methods for scrergen， demonstrate drug safety and efficacy，and scale up manufacturing to meet the stringent regulatory guidelines required for approval。

The post高级Cancer Therapeutics:Increasing Efficacy and Specificity and Reducing Toxicityfirst appeared onBioradiations.]]>

Single-Step Column Purification for H1N1 VirusUsing Nuvia HP-Q AEX Resin

Bioradiations Staff

Learn how a team developed a single-step workflow for column purification of the Influenza A H1N1 subtype using the recently developed Nuvia HP-Q Anion Exchange Resin. This protocol is scalable, efficient, and produced good yields with high purity.

The postSingle-Step Column Purification for H1N1 Virus
Using Nuvia HP-Q AEX Resinfirst appeared onBioradiations.]]>

Advantages of Multiplexing with Bio-Plex Assays

Bioradiations Staff

The Bio-Plex Assay development process is designed to produce high performance multiplex assays. We prioritize sensitivity, broad dynamic range, reproducibility, and shorter incubation times to get you meaningful results faster. Watch this video to learn more about our SMARTS approach to assay development.

The postAdvantages of Multiplexing with Bio-Plex Assaysfirst appeared onBioradiations.]]>

With Cell and Gene Therapies, Success and Quality Control Go Hand-in-Hand

Bioradiations Staff

While the FDA has approved Abecma, the first CAR-T cell therapy in its class, regulatory approval is just the beginning for cell and gene therapies. Such therapies' safety and financial viability rest on a robust manufacturing and quality control program with the flexibility to scale up and out. Droplet Digital PCR is a sensitive biopharmaceutical quality control tool, offering absolute quantification of nucleic acids and other molecules in a sample.

The postWith Cell and Gene Therapies, Success and Quality Control Go Hand-in-Handfirst appeared onBioradiations.]]>

Western Blot University

Bioradiations Staff

Join us for an in-depth dive into western blotting.Whether you are new to western blotting or an experienced user looking for tips， this five-part webinar series has something for you.Slides and downloadable resources will be available for each webinar.Complete all five classes to receive a certificate of completion and a colorful Western Blotting University poster。

The postWestern Blot Universityfirst appeared onBioradiations.]]>

Immune Surveillance in SARS-CoV-2 Vaccine Development

Bioradiations Staff

The ability to characterize the target of cell-mediated immune response is crucial during vaccine development.In studying the characterization of SARS-CoV-2 infection pathogenesis in humans， aresearch team identified neutralizing antibodies that provided context for vaccine antigen design.Discover how the ZE5 Cell Analyzer was used to detect activativation-induced markers，measure intracellular cytokines，and identify spike protein–specific antibodies in a rapid，high-throughnermanput。

The postImmune Surveillance in SARS-CoV-2 Vaccine Developmentfirst appeared onBioradiations.]]>

Introducing the Bio-Plex Pro Human IgG SARS-CoV-2 Serology Assays

Bioradiations Staff

Meet our newest product supporting the fight against SARS-CoV-2: the Bio-Plex Pro Human IgG SARS-CoV-2 N/RBD/S1/S2 4-Plex Panel. This qualitative multiplex immunoassay kit quickly and efficiently detects IgG antibodies against four SARS-CoV-2 antigens (nucleocapsid, receptor binding domain, spike 1, and spike 2).

The postIntroducing the Bio-Plex Pro Human IgG SARS-CoV-2 Serology Assaysfirst appeared onBioradiations.]]>

Purification of Untagged Proteins Made Attainable for Any Researcher

Bioradiations Staff

High purity protein is a common requirement for biochemical and structural studies. A common approach is to recombinantly express an affinity-tagged version of the protein of interest. However, this is not always a viable option. Here we showcase how the NGC Chromatography System and prepacked chromatography columns can be utilized to develop purification workflows for untagged proteins.

The postPurification of Untagged Proteins Made Attainable for Any Researcherfirst appeared onBioradiations.]]>

Countering COVID-19with the Launch of Two NewRT-PCR Kits

Bioradiations Staff

Bio-Rad is proud to introduce our new RT-PCR testing kits for COVID-19.These all-in-one kits are designed for sensitive，specific detection of SARS-Cov-2alone，or simultaneous detection of SARS-Cov-2，influenza A，and influenza B.Read on to learn about each kit’s features features。

The postCountering COVID-19with the Launch of Two NewRT-PCR Kitsfirst appeared onBioradiations.]]>

How FACS, Genetic Screens, and the HAP1 Cell Line Uncover the Biological Mechanisms of Cancer

Bioradiations Staff

Genetic screens are powerful tools for finding genes associated with a particular phenotype. They play an especially important role in cancer research and are leveraged to identify predictive biomarkers that can be used to improve treatment efficacy or trace the progression of genetic alterations that ultimately lead to disease. The HAP1 cancer cell line model and fluorescence-activated cell sorting (FACS) bring efficiency to the development of genetic screens that is making them a force to be reckoned with.

The postHow FACS, Genetic Screens, and the HAP1 Cell Line Uncover the Biological Mechanisms of Cancerfirst appeared onBioradiations.]]>

The Role of ddPCR in Developing Safe and Effective AAV-Based Gene Therapies

Bioradiations Staff

Developing adeno-associated virus (AAV)-mediated gene therapies requires accurate and precise quality control. Read how Droplet Digital PCR technology provides the sensitivity needed to assess the potential safety and effectiveness of these treatments.

The postThe Role of ddPCR in Developing Safe and Effective AAV-Based Gene Therapiesfirst appeared onBioradiations.]]>

Immunological Response Factors to SARS-CoV-2 in Acquired Immunity

Bioradiations Staff

Multiple publications report variation in the duration of acquired immunity to SARS-CoV-2.In this webinar，Bio-Rad scientists review these reports and discuss factors that influence longevity of acquired immunity.Learn about the mechanisms behind acquired immunity and how cytokine and chemokine activity，exivitisting， and more can affect immunity duration。

The postImmunological Response Factors to SARS-CoV-2 in Acquired Immunityfirst appeared onBioradiations.]]>

Automate Your Antibody Purification Workflow at Preparative and Analytical Scale

Bioradiations Staff

Presented by: Katie Schaefer, PhD, Global Product Manager, Bio-Rad
Peter Winship, PhD, Technical Product Manager, Teledyne Cetac Technologies

查看，查看

Purification is a multistep process toward confirmation of a target protein’s purity. In this webinar you will learn how to automate your protein purification workflow by following the creation of a hypothetical monoclonal antibody (mAb). Dr. Schaefer and Dr. Winship expertly demonstrate how the NGC Chromatography System and the AEX-500 series Autosampler work together to maximize screening capability as well as rapidly achieve therapeutic development objectives.

The postAutomate Your Antibody Purification Workflow at Preparative and Analytical Scalefirst appeared onBioradiations.]]>

从顶部水采暖器

Bioradiations Staff

The COVID-19pandemic has captured the attention of the world and won’t let go.And that has sparked effor creative solutions in some surprising places.Wastewater is not where most peoples’minds go first when they think of airborne diseases，but it holds much promise for tracing and redictRS-Corges。

The postTop Questions from Our Wastewater Surveillance Webinarfirst appeared onBioradiations.]]>

Inflamed in the Brain: A Protocol for Studying Neuroinflammation in Mouse Brain Tissue

Bioradiations Staff

Mice are critical model organisms for the study of neuroinflammation. But tissue quantity is often a limiting factor. In a recent paper, researchers describe a protocol for analysis of 33 cytokines and chemokines using only 50 μl of tissue homogenate. The remaining homogenate can be used for RNA extraction or other analysis.

The postInflamed in the Brain: A Protocol for Studying Neuroinflammation in Mouse Brain Tissuefirst appeared onBioradiations.]]>

Are biofuels good for the planet?

Bioradiations Staff

Will the trend toward using biofuels benefit the earth? Listen in as our Chromies team discusses different types of biofuels and how chromatography plays a role in developing mass produced and energy efficient biofuels.

The postAre biofuels good for the planet?first appeared onBioradiations.]]>

Multiplex Immunoassays in the Race for a COVID-19 Vaccine

Bioradiations Staff

In vaccine development, safety and efficacy are critical. Recent studies have shown that multiplex immunoassays offer a flexible way to monitor immune responses. With the ever-increasing pressure on scientists to develop a practical COVID-19 vaccine, multiplex immunoassays stand out as a proven tool.

The postMultiplex Immunoassays in the Race for a COVID-19 Vaccinefirst appeared onBioradiations.]]>

Serving your Downstream Purification Needs

Bioradiations Staff

The Process Chromatography Team at Bio-Rad offers a variety of resources to address scientists’ needs during the downstream purification process. Visit our robust online library, which contains application notes, tutorials, webinars, and more, or contact us to speak with a specialist or request a customized seminar.

The postServing your Downstream Purification Needsfirst appeared onBioradiations.]]>

Top 5 Challenges Faced by AAV Developers Today

Bioradiations Staff

Adeno-associated viruses (AAVs) are some of the most commonly used viral vectors for gene therapy, supporting approximately 250 clinical trials to date. However, the manufacturing processes are challenging to scale. Read about five key issues that gene therapy manufacturers who use AAVs need to look out for.

The postTop 5 Challenges Faced by AAV Developers Todayfirst appeared onBioradiations.]]>

Introducing the Reliance Select cDNA Synthesis Kit

Bioradiations Staff

The Reliance Select cDNA Synthesis Kit is the newest reverse transcription product from Bio-Rad. This high-performance kit features Reliance Reverse Transcriptase, a novel chimeric enzyme that delivers superior results across a broad dynamic range, even with challenging samples. The Reliance Select cDNA Synthesis Kit delivers more accurate reverse transcription quantitative PCR (RT-qPCR) results, even from samples containing PCR inhibitors or degraded RNA.

The postIntroducing the Reliance Select cDNA Synthesis Kitfirst appeared onBioradiations.]]>

The Role of Aberrant Cytokine Activity in COVID-19 Disease

Bioradiations Staff

Presented by:Kenneth Oh, PhD, Collaborations, Applications, and New Technology Senior Global Manager
Kelly King, PhD, Field Application Specialist II
Brad VanderWielen, PhD, Field Application Specialist II
Candice Cox, Global Marketing Manager, Immunoassays

查看，查看

Emerging reports from the COVID 19 pandemic include a spectrum of patient symptoms due to the host immune response. In this webinar, Bio-Rad scientists discuss early research and nascent hypotheses about the pathophysiology of SARS CoV 2–induced COVID 19 disease by evaluating cytokine and chemokine profiles, the role of chronic inflammation in comorbidities, and the arc of immune resolution of historical virulent pathogens, such as SARS and MERS.

The postThe Role of Aberrant Cytokine Activity in COVID-19 Diseasefirst appeared onBioradiations.]]>

A New International Standard to Measure DNA？

Bioradiations Staff

From quantifying a patient’s tumor DNA to counting the viral load of an individual infected with COVID-19，the breadth of digital PCR（dPCR）applications continues to grow and fulfill critical scientific needs。dPCR offers the ability to count nucleic acid molecules directly，rather than extrapolating the quantity from standard curves as with many other methods.By harmonizing diagnostic procedures on dPCR platforms，the scientific and medical communities can become more core cordinated and efficient。

The postA New International Standard to Measure DNA？first appeared onBioradiations.]]>

Data Standardization

Bioradiations Staff

Increasingly, biopharma research & development experimental data are siloed and stored in varying formats. This makes it difficult to search, retrieve and share data. Furthermore, these data are often not interoperable, making it impossible to compare. Data needs to be better managed to be more collaborative, shareable, and interoperable, in order to accelerate research and continue making breakthroughs. Data standardization aims to forge a path toward machine-readable and actionable data that can be found, accessed, and reused with minimal human intervention.

The postData Standardizationfirst appeared onBioradiations.]]>

7 Tips for Purchasing Your Next Cell Sorter

Bioradiations Staff

Presented here are some tips to help you avoid buyer’s remorse and make an educated decision about which instrument to purchase. These tips provide you with the tools to make an informed decision when purchasing a cell sorter.

The post7 Tips for Purchasing Your Next Cell Sorterfirst appeared onBioradiations.]]>

Introducing the CFX Opus Real-Time PCR Systems — A Modern Take on Bio-Rad Consistency

Bioradiations Staff

Coming soon: The next iteration in Bio-Rad’s tradition of qPCR excellence. The compact CFX Opus Real-Time PCR System is more connected, consistent, and easier to use than ever before, and is available in 96- and 384-well formats. The CFX Opus Systems launch with our new BR.io cloud platform and the latest version of CFX Maestro Software, for complete instrument control and data analysis capabilities.

The postIntroducing the CFX Opus Real-Time PCR Systems —
A Modern Take on Bio-Rad Consistencyfirst appeared onBioradiations.]]>

Sorting an Old Problem: Are Cells Stressed by Fluorescence-Activated Cell Sorting?

Bioradiations Staff

Fluorescence-activated cell sorting is a valuable tool for research, but could the physical forces of sorting stress the cells, altering their behavior and confounding experimental results? Recent research found that although cell sorting activated p38 MAPK stress signaling, no functional or structural changes were observable. The results indicate that jet-in-air systems such as the Bio-Rad S3e Cell Sorter do not alter cell behavior.

The postSorting an Old Problem: Are Cells Stressed by Fluorescence-Activated Cell Sorting?first appeared onBioradiations.]]>

How to Make a Successful Vaccine

Bioradiations Staff

As phase 3 clinical trials of investigational vaccines for COVID-19 begin in the U.S., you may be wondering what it takes to make an effective vaccine? In case you missed it, check out ourHanging with My Chromiespodcast, episodes 6 and 10 on vaccine development and viral spread, and learn about the role chromatography plays in making a successful vaccine.

The postHow to Make a Successful Vaccinefirst appeared onBioradiations.]]>

Episode 7: Data Standardization

Bioradiations Staff

Capture, management, and sharing of research data and metadata are a growing concern for the biopharma industry. Learn how data standardization can facilitate collaboration and improve accessibility.

The postEpisode 7: Data Standardizationfirst appeared onBioradiations.]]>

10 Tips for Setting Up a Successful Cell Sorting Experiment

Bioradiations Staff

Incorporating fluorescence-based cell sorting into your lab grants you powerful access to new research areas and rarer cell types without sacrificing efficiency or results. New, powerful techniques like CRISPR and single-cell analysis are enhanced by the isolation of specific cells. But isolating cell populations of the right quality and quantity is both challenging and time consuming. We offer some tips to set yourself up for success and get the most out of your sorts.

The post10 Tips for Setting Up a Successful Cell Sorting Experimentfirst appeared onBioradiations.]]>

Globally Aware Genomes — an Informatics Challenge

Bioradiations Staff

The Human Genome Project was completed nearly two decades ago, in 2003. The primary vision of this project was to produce a human reference genome, a representative example of the set of genes in one idealized individual human. However, the currently available reference genomes do not represent the genetic diversity found across different human populations. As such, any downstream products (drugs therapies, personalized medicine, etc.) derived from the human genome will not accurately represent the vast majority of the human population.

The postGlobally Aware Genomes — an Informatics Challengefirst appeared onBioradiations.]]>

Expert Coffee Chats: Coffee Chat #4 – Droplet Digital PCR in Cell and Gene Therapy

Bioradiations Staff

Presented by: Matthew L. Turner, PhD, Field Application Scientist - ddPCR, NGC and qPCR, Tara Ellison, PhD, Senior Field Application Scientist

Date: June 17, 2020
Time: 9 AM, U.S. Pacific time

Robust methodology for viral titer using ddPCR
Precise copy number determination & improved confidence in acceptance criteria
Enhance your throughput and minimize hands-on time
Learn how ddPCR is used in other key applications

The postExpert Coffee Chats: Coffee Chat #4 – Droplet Digital PCR in Cell and Gene Therapyfirst appeared onBioradiations.]]>

Analyzing Carbohydrates

Bioradiations Staff

Carbohydrates are among the most important components of foods, providing energy as well as flavor, texture, and other physical properties. Identification and quantification of carbohydrates in food is commonly performed using high-performance liquid chromatography. Bio-Rad Aminex Ion Exchange Resins have become the industry standard for carbohydrate and organic acid analysis.

The postAnalyzing Carbohydratesfirst appeared onBioradiations.]]>

A Novel CAR-T Cell Therapy Approach Using Fluorescence-Activated Cell Sorting and Stem Cell Transplantation

Bioradiations Staff

Successful chimeric antigen receptor- (CAR-) T cell therapy requires a target antigen that is unique to cancer cells. But what happens when there are no unique antigens? Researchers at Columbia University Medical Center addressed this problem by replacing healthy non-target cells with genetically modified versions lacking the CAR-T cell target. Their results, published in PNAS, may provide a new avenue for treatment of some types of cancer.

The postA Novel CAR-T Cell Therapy Approach Using Fluorescence-Activated Cell Sorting and Stem Cell Transplantationfirst appeared onBioradiations.]]>

Episode 6: Genomic Data Disparities

Bioradiations Staff

Sequencing is used to identify novel drug targets and genetically stratifying clinical trial patients, improving the power of precision medicine. However, the global disparity of genomic technologies is increasing. How will this affect drug development, particularly for non-European ethnicities? Why is it important to have a global context for targeted therapies?

The postEpisode 6: Genomic Data Disparitiesfirst appeared onBioradiations.]]>

Improving CRISPR-Cas9 Gene Editing:Tackling the HDR Inefficiency Problem

Bioradiations Staff

arecent publication showed that expression of a protein involved in homology-directed repair（HDR）can improve efficiency of CRISPR-Cas9gene editing。Learn how manipulation of DNA repair pathways and improvements to gene editing workflows，such as the addition of cell sorting，can facilitate applications of CRISPR-Cas9technology。

The postImproving CRISPR-Cas9 Gene Editing:
HDR Inefficiency Problemfirst appeared onBioradiations.]]>

Lab of the Future

Bioradiations Staff

In an effort to increase the return on investment of research and development, pharmaceutical companies are constantly looking for ways to reduce costs. One way to do this is to incorporate technology and minimize human interaction. As a result, scientists will have more time to focus on the design and analysis of experiments. How will the Lab of the Future reflect these changes?

The postLab of the Futurefirst appeared onBioradiations.]]>

Active Machine Learning in Drug Discovery

Bioradiations Staff

Drug discovery and development are both time and resource intensive since a lot of different compounds need to be screened across a lot of different targets.See how machine learning models can be used to predict screening results and how active learning algorithms can be used to efficiently septh expertiment toose models。

The postActive Machine Learning in Drug Discoveryfirst appeared onBioradiations.]]>

Reference Gene Selection Using PrimePCR Plates and CFX Maestro Software

Bioradiations Staff

Reference gene selection and validation are very important for gene expression studies that involve different samples or experimental conditions and therefore are absolutely necessary before any further exploration. See how PrimePCR Reference Gene Selection Panels and CFX Maestro Software provide an easy-to-use system with which to select appropriate reference genes.

The postReference Gene Selection Using PrimePCR Plates and CFX Maestro Softwarefirst appeared onBioradiations.]]>

Biosimilar Purification with Ion Exchange and Mixed-Mode Resins

Bioradiations Staff

Presented by: Randy Drevland, PhD, Senior Applications Scientist

查看，查看

Dr. Drevland presents a viable alternative workflow for the development of a HUMIRA-like biosimilar using IEX and mixed-mode resins.

Episode 5: Lab of the Future (LoTF)

Bioradiations Staff

Life science companies are looking to modernize their research environments and build the Lab of the Future. From early discovery to preclinical research, how can technology help automate the lab and accelerate discoveries?

The postEpisode 5: Lab of the Future (LoTF)first appeared onBioradiations.]]>

GMP-Compliant Production of CAR-T Cells Using mRNA Transfection

Bioradiations Staff

Many patients with treatment-resistant blood cancers have found new hope in chimeric antigen receptor (CAR)-T cell therapy. But generation of CAR-T cells at clinical scale can be challenging. Find out how the Gene Pulser Xcell Electroporation System can be used to reduce costs and risks associated with clinical-scale CAR-T cell production, while maintaining GMP compliance.

The postGMP-Compliant Production of CAR-T Cells Using mRNA Transfectionfirst appeared onBioradiations.]]>

Data Integration and Visualization Approaches

Bioradiations Staff

Over the past several decades, research informatics (RIS) environments within BioPharma organizations have evolved dramatically, increasing the demand for simple and easy data integration and visualization. Learn about the tools available to address this need and what the future could hold.

The postData Integration and Visualization Approachesfirst appeared onBioradiations.]]>

Turning Back the Clock on Mouse Neural Progenitor Cells

Bioradiations Staff

Is the fate of an embryonic cell determined by the age of the cell or the age of the embryo? To explore this question, researchers isolated and transplanted live neural cells from mouse embryos at different stages of development. Learn about their findings and how the S3e Cell Sorter helped achieve this incredible feat.

The postTurning Back the Clock on Mouse Neural Progenitor Cellsfirst appeared onBioradiations.]]>

A Powerful Solution for NGS RNA Library Preparation

Bioradiations Staff

The SEQuoia Complete Stranded RNA Library Prep Kit is the newest addition to Bio-Rad’s next-generation sequencing (NGS) space. Capturing long and short RNAs and validated with FFPE and low-quality samples, see why it should be your top choice for high-performance RNA-Seq library prep.

The postA Powerful Solution for NGS RNA Library Preparationfirst appeared onBioradiations.]]>

Episode 4: Active Learning in Drug Discovery

Bioradiations Staff

What are the theories, algorithmic principles, and limitations of active learning? What are some current applications of active learning within BioPharma drug screening and optimization? How can active learning accelerate multi-dimensional drug discovery? Find out here.

The postEpisode 4: Active Learning in Drug Discoveryfirst appeared onBioradiations.]]>

Artificial Intelligence in Drug Development

Bioradiations Staff

Artificial intelligence (AI) relies on building a model and applying it to solve a specific problem. Read how AI is being used to accelerate research and development, process development, manufacturing, and clinical trials within genomics.

The postArtificial Intelligence in Drug Developmentfirst appeared onBioradiations.]]>

Hanging with My Chromies Podcast Series

Bioradiations Staff

TheHanging with My Chromiespodcast series is focused on the many surprising applications of chromatography and the stories surrounding them. Join us every month to see what you can learn.

The postHanging with My Chromies Podcast Seriesfirst appeared onBioradiations.]]>

Maximizing the Efficiency of Production Workflows with NGC Chromatography Systems

Bioradiations Staff

See how an antibody expression service provider, Evitria (Zurich, Switzerland) optimized and expanded their antibody production services using the NGC Chromatography Systems to meet the growing demands of their customers.

The postMaximizing the Efficiency of Production Workflows with NGC Chromatography Systemsfirst appeared onBioradiations.]]>

Episode 3: Next-Generation Data Integration, Visualization, and Exploration

Bioradiations Staff

What is the vision of interactive data exploration beyond enriching visualizations and facilitating the integration of data? Within the context of research, what are the challenges and opportunities in building next-generation visual analytics? Listen to find out.

The postEpisode 3: Next-Generation Data Integration, Visualization, and Explorationfirst appeared onBioradiations.]]>

Integrating Viral Clearance into Your Process Development — A Case Study Using a Mixed‑Mode Chromatography Resin

Bioradiations Staff

Presented by: Akunna Iheanacho, Director of Research and Development at Texcell – North America
Xuemei He, R&D Manager, Chromatograpy Media Chemistry at Bio-Rad Laboratories

查看，查看

Learn about evaluating viral clearance using a DOE approach with a mixed-mode chromatography resin.

The postIntegrating Viral Clearance into Your Process Development — A Case Study Using a Mixed‑Mode Chromatography Resinfirst appeared onBioradiations.]]>

Cloud Migration Strategies for BioPharma

Bioradiations Staff

Many BioPharma organizations are moving to the cloud in order to improve the performance and speed, cost, physical and personnel resources, security, back up, and sharing/collaboration associated with large, complex datasets. Learn about the different strategies used in migrating to the cloud.

The postCloud Migration Strategies for BioPharmafirst appeared onBioradiations.]]>

Protein Thermal Shift Assays Made Easy with Bio-Rad’s Family of CFX Real-Time PCR Detection Systems

Bioradiations Staff

Protein thermal shift assays enable quick and easy buffer optimization for increased protein stability. See how Bio-Rad’s family of CFX Real-Time PCR Detection Systems can measure protein thermal stability with higher throughput and more buffer systems than traditional circular dichroism detection.

The postProtein Thermal Shift Assays Made Easy with
Bio-Rad’s Family of CFX Real-Time PCR Detection Systemsfirst appeared onBioradiations.]]>

Challenging the Microbial Sanitization of a Liquid Chromatography System

Bioradiations Staff

When developing biologics or biotherapeutics, it is imperative that no contaminating or hazardous residual components from the organisms responsible for protein expression remain after purification. See how the NGC Chromatography System was challenged with microbes and efficiently sanitized, making it ideal for the small-scale production of biotherapeutics.

The postChallenging the Microbial Sanitization of a Liquid Chromatography Systemfirst appeared onBioradiations.]]>

Episode 2: The Realities of AI/ML

Bioradiations Staff

Artificial Intelligence (AI) and Machine Learning (ML) are big topics getting lots of attention within BioPharma. What is the role of AI/ML in genomics? How can we separate the hype of AI/ML from reality? Listen in to find out this and more.

The postEpisode 2: The Realities of AI/MLfirst appeared onBioradiations.]]>

Episode 1: Moving to the Cloud

Bioradiations Staff

Listen to the podcast. PROLOGUE Charlene Son Rigby: They are really looking to get their test validated and launch their test as quickly as possible. Being able to do that in even as short as a three month period and being able to kind of set up there, you know, the NGS operations, um, as well as getting the IT systems piece up and running is a pretty significant set of activities to complete. The cloud really enables them to do that. Kashef Qaadri: My name is Kashef, and this is BioRad.io — a group of biologists turned bioinformaticians bring you into the world of research and development informatics by interviewing the people responsible for implementing systems and technologies to a unique and diverse set of use cases. Several biopharma organizations are dealing with similar issues, technical, executive buy-in, mindset. Well, organizations can learn from the experience of others and ...

The postEpisode 1: Moving to the Cloudfirst appeared onBioradiations.]]>

Do More with Less: Five Steps to Great Results Using One-Step Multiplex RT-qPCR

Bioradiations Staff

One-step multiplex RT-qPCR is a technique used to rapidly quantify multiple targets directly from RNA in a single reaction. But proper optimization and validation is essential for its success. These five tips will have you designing primers and probes, selecting reporters, and validating and optimizing your experiments like a pro.

The postDo More with Less: Five Steps to Great Results Using One-Step Multiplex RT-qPCRfirst appeared onBioradiations.]]>

Expanded Droplet Digital PCR Multiplexing Capability Using Two Different Strategies

Bioradiations Staff

Multiplexing with Droplet Digital PCR (ddPCR) allows for improved sensitivity and precision, as well as increased low-level detection in limited sample types like liquid biopsies. Learn about amplitude and probe-mixing multiplexing and how our ddPCR Assays can help set you up for multiplexing success.

The postExpanded Droplet Digital PCR Multiplexing Capability Using Two Different Strategiesfirst appeared onBioradiations.]]>

Fluorescent Immunoblots and Multiplex Analysis

Bioradiations Staff

Presented by:Gary F.Ross，PhD，Proteomics Field Application Scientist

查看，查看

Learn best practices for fluorescent western blotting，including multiplex analysis and image acquisition。

The postFluorescent Immunoblots and Multiplex Analysisfirst appeared onBioradiations.]]>

Purification of Antibodies with Nuvia aPrime 4A Hydrophobic Anion Exchange Resin

Bioradiations Staff

Our new hydrophobic anion exchange mixed-mode resin, Nuvia aPrime 4A, has been developed to overcome existing challenges in antibody purification. See how we purified an acidic and basic antibody through bind-elute and flow-through modes of purification, respectively, and helped to improve process productivity and economy.

The postPurification of Antibodies with Nuvia aPrime 4A Hydrophobic Anion Exchange Resinfirst appeared onBioradiations.]]>

Tyrosine Phosphorylation of EGF R

Bioradiations Staff

Growth factors are protein signaling molecules that play crucial roles in the regulation of numerous cellular processes such as proliferation, differentiation, and survival. Learn more about the phosphorylation of one such factor, the epidermal growth factor receptor (EGF R).

The postTyrosine Phosphorylation of EGF Rfirst appeared onBioradiations.]]>

Sensitive Codetection of Viral-Pathogen RNA and DNA Using One-Step Multiplex RT-qPCR

Bioradiations Staff

RT-qPCR is a well-established method for the detection, quantification, and typing of different microbial agents. However, when dealing with the challenges of pathogen detection, not all RT-qPCR reagents are created equal. See how we used a novel one-step multiplex RT-qPCR supermix to demonstrate sensitive codetection of viral RNA and DNA targets in a multiplex setting.

The postSensitive Codetection of Viral-Pathogen RNA and DNA
Using One-Step Multiplex RT-qPCRfirst appeared onBioradiations.]]>

修复故障专家网前路现场Guide to qPCR

Bioradiations Staff

qPCR has become ubiquitous for nucleic acid detection and quantification and remains the gold standard for a wide array of applications. To help you publish high-quality, reproducible data that reflect true experimental conditions, we’ve developed this comprehensive guide to performing the ultimate qPCR experiment.

The post修复故障专家网前路现场Guide to qPCRfirst appeared onBioradiations.]]>

A New AEX Mixed-Mode Chromatography Resin for High Selectivity and Recovery

Bioradiations Staff

Presented by: Xuemei He, PhD, R&D Manager, Chromatography Media Chemistry, Bio-Rad Laboratories

查看，查看

This webinar highlights the properties of Bio-Rad’s newest hydrophobic AEX chromatography resin, Nuvia aPrime 4A, which is designed to facilitate selective and reversible binding of target molecules for higher purity and recovery over traditional chromatography resins.

The postA New AEX Mixed-Mode Chromatography Resin for High Selectivity and Recoveryfirst appeared onBioradiations.]]>

New Product Feature: Multiplex RT-qPCR in One Step

Bioradiations Staff

Using RT-qPCR for RNA, though critical in several industries, is often met with challenges. Many current options don't allow for multiplexing or high-throughput operation. Bio-Rad's new Reliance One-Step Multiplex Supermix was designed to grant researchers the expanded, efficient capabilities they need in RT-qPCR. This article presents some of the performance data from the new supermix and describes how exceptional it is at multiplex detection.

The postNew Product Feature: Multiplex RT-qPCR in One Stepfirst appeared onBioradiations.]]>

在Western Blotting Technology:Western Workflow That Delivers More Precise，Accurate，and Reproducible Results

Bioradiations Staff

Presented by:Sean C.Taylor，MBA，PhD，Field Application Scientist Manager

查看，查看

Learn how to produce journal-ready reproducible and quantitative western blot data。

The post在Western Blotting Technology:Western Workflow That Delivers More Precise，Accurate，and Reproducible Resultsfirst appeared onBioradiations.]]>

Discover Our Capabilities

Bioradiations Staff

From flow cytometry to chromatography to western blot imaging to PCR plastics, learn more about Bio-Rad and see what’s possible in your research.

The postDiscover Our Capabilitiesfirst appeared onBioradiations.]]>

Stop Compromising between High Yield and High Purity in Downstream Purifications

Bioradiations Staff

When it comes to downstream protein purifications, does it feel like you’re in a constant tug of war between high yield and high purity? With Bio-Rad’s Nuvia aPrime 4A Resin, you don’t have to choose. With both ion exchange and mixed-mode properties, see how the resin is able to deliver simultaneous purity and yield, for even difficult-to-purify proteins.

The postStop Compromising between High Yield and High Purity in Downstream Purificationsfirst appeared onBioradiations.]]>

Maximizing Your Mouse: Using the Power of Bio‑Plex to Analyze Mouse Models of Disease and Treatment

Bioradiations Staff

Presented by: Daniel Braunschweig, PhD, Proteomics Field Application Scientist Leader

查看，查看

This webinar provides an overview of multiplexing technology for research use with mouse samples and highlights the associated benefits to your drug discovery workflow. Specific topics include:

The postMaximizing Your Mouse: Using the Power of Bio‑Plex to Analyze Mouse Models of Disease and Treatmentfirst appeared onBioradiations.]]>

Changing the Treatment Landscape with the Development of Biologics

Bioradiations Staff

Biologics are transforming the healthcare landscape and bringing us closer to the realization of personalized solutions to our health problems. Learn about what biologics are and how protein purification plays a key role in their overall success as a therapeutic.

The postChanging the Treatment Landscape with the Development of Biologicsfirst appeared onBioradiations.]]>

10 Tips for Western Blot Detection of Phosphorylation Events

Bioradiations Staff

Being able to interrogate protein phosphorylation events and aberrant phosphorylation levels is critical to our understanding of various biological and pathological processes. However, detection of phosphorylated proteins in western blots can be challenging. These ten tips will help you generate robust data and cleaner blots.

The post10 Tips for Western Blot Detection of Phosphorylation Eventsfirst appeared onBioradiations.]]>

A Model System for Fast Screening of Optimal Protein Purification Conditions

Bioradiations Staff

See how you can efficiently reduce identification of optimal protein purification conditions from five days to just 18 hours. All you need is a DOE model and the Multivariable Scouting tool and automation abilities of the NGC Chromatography System.

The postA Model System for Fast Screening of Optimal Protein Purification Conditionsfirst appeared onBioradiations.]]>

Develop an Immunotherapy in Augmented Reality

Bioradiations Staff

Every year cancer kills eight million people worldwide. By 2030, the number of annually diagnosed cases will exceed 21.7 million resulting in 13 million cancer deaths due to aging and population growth. Join the fight against cancer by embarking on a research mission to develop a personalized immunotherapy using augmented reality.

The postDevelop an Immunotherapy in Augmented Realityfirst appeared onBioradiations.]]>

Moving Forward with Immunotherapies for Cancer

Bioradiations Staff

Frost & Sullivan, a business consulting firm involved in market research and analysis, conducted a thought leadership forum that brought together experts in the field of immuno-oncology. Follow their discussions about the current state of immunotherapies and the key challenges and future approaches to the targeted use of the immune system in cancer treatment.

The postMoving Forward with Immunotherapies for Cancerfirst appeared onBioradiations.]]>

One for All — The Universal qPCR Reagent

Bioradiations Staff

Passive reference dyes are included in qPCR/RT-qPCR supermixes to compensate for pipetting errors and thermal and/or optical differences in real-time instruments. Our universal line of reagents eliminates the need for spiking in dyes or having to worry about how much ROX your instrument needs. See how your qPCR experiments can also generate more reliable data and be reproducible by anyone.

The postOne for All — The Universal qPCR Reagentfirst appeared onBioradiations.]]>

Organs-On-Chips: Solving Persistent Pharmacokinetic Problems

Bioradiations Staff

Mock organs the size of a thumb drive are poised to revolutionize drug development and discovery. Dr. Dan Tagle at the NIH, the latest guest onBrilliant Science单击功能区上，specializes in divining new ways to innovate organs-on-chips, and he's even sending them to space. Read more about this growing technology and its fascinating applications.

The postOrgans-On-Chips: Solving Persistent Pharmacokinetic Problemsfirst appeared onBioradiations.]]>

Biomarkers for the Brain

Bioradiations Staff

Frost & Sullivan, a business consulting firm involved in market research and analysis, conducted a thought leadership forum that brought together experts in the field of CNS biomarkers. Follow their discussions about technological advancements in the field and future implications of the current research and development.

The postBiomarkers for the Brainfirst appeared onBioradiations.]]>

Brilliant Science Podcast Series

Bioradiations Staff

The Brilliant Science podcasts will introduce you to some of the amazing science being done around the world. Join us every month to see what you can learn.

The postBrilliant Science Podcast Seriesfirst appeared onBioradiations.]]>

Discover lncRNA: Understanding the Long Noncoding Transcriptome

Bioradiations Staff

Learn about the exciting new field of long noncoding RNA (lncRNA) and how this newly discovered class of RNA compares to messenger RNA (mRNA).

The postDiscover lncRNA: Understanding the Long Noncoding Transcriptomefirst appeared onBioradiations.]]>

See the Signal-Illuminating the Pathway to Confident Western Blot Detection of Phosphorylated Proteins

Bioradiations Staff

Presented by：Rachael Preston，PhD，Applications Scientist，Bio-Rad Laboratories

查看，查看

The most common method for assessing the phosphorylation state of a protein is western blotting.In this webinar we talk you through how to fine-tune your western blot protocol to detect phosphorylation events and generate publication-quality western blots。

The postSee the Signal-Illuminating the Pathway to Confident Western Blot Detection of Phosphorylated Proteinsfirst appeared onBioradiations.]]>

Alzheimer’s Disease: A Smoking Gun with No Suspect

Bioradiations Staff

For the past 30 years, there has been one assumed culprit of Alzheimer’s disease (AD) — beta-amyloid. However, researchers have been unsuccessful in developing effective therapies targeting this protein. Understand the history of AD and beta-amyloid and see what other biomarkers are being investigated as potential therapeutic targets.

The postAlzheimer’s Disease: A Smoking Gun with No Suspectfirst appeared onBioradiations.]]>

Six Tips to Improve Your Co-IP Results

Bioradiations Staff

Co-immunoprecipitation (co-IP) is a great way to identify target protein complexes and interacting partners. Though the technique can be highly informative, it is also challenging to master. The six tips and protocol outlined in this article will help you achieve successful co-IP results.

The postSix Tips to Improve Your Co-IP Resultsfirst appeared onBioradiations.]]>

Single-Step Influenza and Dengue Virus Purification with Mixed-Mode CHT Ceramic Hydroxyapatite XT Media

Bioradiations Staff

See how you can use CHT XT Mixed-Mode Media to recover over 75% of your virus in a single purification step. All this while reducing contaminating proteins by over 90% and removing over 60% of dsDNA. Get simple, fast, and reproducible viral purification with CHT XT.

The postSingle-Step Influenza and Dengue Virus Purification with Mixed-Mode CHT Ceramic Hydroxyapatite XT Mediafirst appeared onBioradiations.]]>

Bio-Plex Manager Software Overview

Bioradiations Staff

Presented by: Brett Houser, Bio-Plex Multiplex Immunoassay Product Manager, Protein Quantitation Group

查看，查看

Bio-Plex Manager Software is a powerful, intuitive tool used to generate and analyze xMap data. In this webinar you will:

Learn how to create an assay protocol
Learn how to acquire data
Understand basic software parameters
Learn about general functionality and navigation
Master optimization of standard curves and export data for further analysis

The postBio-Plex Manager Software Overviewfirst appeared onBioradiations.]]>

A 16-Color Flow Cytometry Panel to Monitor Checkpoint Inhibitor Expression and T-Cell Exhaustion Following Treatment with the PD1 Inhibitor Nivolumab

Bioradiations Staff

Presented by: Angie Green, PhD, Senior Scientist

查看，查看

We discuss using a multiparameter flow cytometry panel to monitor T-cell exhaustion states and the expression of checkpoint inhibitors. We used an in vitro model; however, the panel is designed to be compatible with clinical samples to monitor immunotherapy.

The postA 16-Color Flow Cytometry Panel to Monitor Checkpoint Inhibitor Expression and T-Cell Exhaustion Following Treatment with the PD1 Inhibitor Nivolumabfirst appeared onBioradiations.]]>

Large Biomolecule Purification with a New High-Performance Anion Exchange Resin

Bioradiations Staff

Presented by: Hana Kim, PhD, Global Product Manager, Process Chromatography
Jiali Liao, PhD, Principal Scientist, Process Chromatography

查看，查看

Learn about Nuvia HP-Q Resin, a new rigid bead engineered with large pores and optimized surface extenders to deliver both high binding capacity and high recovery at high flow rates. It is ideal for large molecule purification, including plasma proteins, viruses, and VLPs.

The postLarge Biomolecule Purification with a New High-Performance Anion Exchange Resinfirst appeared onBioradiations.]]>

A New Mixed-Mode Media for Downstream Purification

Bioradiations Staff

Presented by: Daniel Yoshikawa, PhD, Global Product Manager, Process Chromatography
Mark A. Snyder, PhD, R&D Applications Manager, Process Chromatography

查看，查看

Watch this webinar to learn about a new mixed-mode chromatography media used to purify biomolecules at process scale. It delivers unique selectivity and robust, uniformly sized beads with excellent pressure-flow properties ideal for bioprocess applications.

The postA New Mixed-Mode Media for Downstream Purificationfirst appeared onBioradiations.]]>

Traumatic Brain Injury — A Controversial and Deadly Epidemic

Bioradiations Staff

Ever wonder how football is linked to degenerative brain disease? Find out here. Also, learn about novel biomarkers for traumatic brain injury (TBI), the current state of TBI research, and promising new approaches for developing a robust diagnostic tool. Discover tests currently used to diagnose TBI and read about unusual techniques used to develop reliable biomarkers.

The postTraumatic Brain Injury — A Controversial and Deadly Epidemicfirst appeared onBioradiations.]]>

R-Loops and Their Key Role in Cancer Research

Bioradiations Staff

R-loops are being investigated as potential therapeutic targets for cancer. Find out what they are, how they form, how their formation is controlled by our cells, and, above all, their potential as therapeutic targets.

The postR-Loops and Their Key Role in Cancer Researchfirst appeared onBioradiations.]]>

Say Hello to Your Littlest Friends — the Microbiota

Bioradiations Staff

How well do you understand your microbiota? Dr. Allyson Byrd of Genentech, the fourth guest onBrilliant Science单击功能区上，is a bioinformatician focusing on parsing all the data our microbiomes have to offer. Read about the value of analyzing microbiota and how Dr. Byrd hopes to leverage the results.

The postSay Hello to Your Littlest Friends — the Microbiotafirst appeared onBioradiations.]]>

To Boldly Flow: Gain Confidence to Start Flow Cytometry

Bioradiations Staff

Presented by: Mike Blundell, PhD, Product Manager

查看，查看

Flow cytometry is a powerful technique used widely in biological research, but if you are just beginning your flow journey, it can be hard to know where to start. In this webinar, you will:

Learn the important steps to obtaining better flow cytometry data
Get advice on how to apply this knowledge to improve your experiments
Find out how Bio-Rad’s panel builder tool can help you design your experiments, no matter how many colors you plan to use

The postTo Boldly Flow: Gain Confidence to Start Flow Cytometryfirst appeared onBioradiations.]]>

Flow Cytometry — A Gateway for Discovering More about Small Vesicles

Bioradiations Staff

Small vesicles were identified over 50 years ago but scientists are still trying to understand their biology and role in disease. These vesicles have become relevant for monitoring, diagnosing, and treating complex diseases such as cancer. Yet, because of their small size compared to cells, they require intricate technologies to truly understand their impact in research. Learn about the various technologies used to study small vesicles and discover the power of flow cytometry for learning more about these valuable vesicles.

The postFlow Cytometry — A Gateway for Discovering More about Small Vesiclesfirst appeared onBioradiations.]]>

10 Tips for Western Blot Detection of Proteins Present in Tissue Lysates

Bioradiations Staff

Extracting proteins from tissue lysates for western blotting can be a challenge. From knowing how to process your tissue to verifying protein loading to including suitable controls, there is a lot to keep track of. The ten tips in this article can help you on your way to generating reproducible and reliable blots and do better western blotting overall.

The post10 Tips for Western Blot Detection of Proteins Present in Tissue Lysatesfirst appeared onBioradiations.]]>

Got Purification Troubles?

Bioradiations Staff

Use our interactive infographic to find out how your resin-of-choice fares in on-column aggregate formation during monoclonal antibody purification. And find out what you can do to minimize these on-column aggregates.

The postGot Purification Troubles?first appeared onBioradiations.]]>

Defining the New Normal in Quantitative Western Blot Data

Bioradiations Staff

Normalization of western blot data is very crucial in quantitating proteins. Normalization of band intensity of proteins of interest with the band intensity of housekeeping proteins (HKP) is routinely done in labs. But more and more journals question the validity of using HKPs in normalization and are demanding more validations and tests. An alternative method is to use total protein normalization (TPN) for normalization. Explore the TPN option and see how you can get reliable western blot data easily.

The postDefining the New Normal in Quantitative Western Blot Datafirst appeared onBioradiations.]]>

Multiplex Cytokine Immunoassays — Minimizing Effort, Maximizing Results

Bioradiations Staff

Since the first cytokine was identified over 60 years ago, a lot has been done to better understand these molecules. The use of multiplex immunoassays is one such way, though they aren’t considered quite as mainstream yet. Learn about how the SMARTS approach can be used to better align user experience to the performance characteristics of these multiplex assays and hopefully transition them to a more mainstream role in research.

The postMultiplex Cytokine Immunoassays — Minimizing Effort, Maximizing Resultsfirst appeared onBioradiations.]]>

A Resin Built Specifically for Large Biomolecule Purifications

Bioradiations Staff

Nuvia HP-Q is a high-performance strong anion exchange resin designed for purification of large biomolecules. See how its optimized particle and pore size leads to high target recovery and high-throughput purifications.

The postA Resin Built Specifically for Large Biomolecule Purificationsfirst appeared onBioradiations.]]>

Finding a Good Antibody: Part III – Publish Meaningful Data

Bioradiations Staff

In the first two articles in ourFinding a Good Antibodyseries, you learned how to select the best antibodies and received tips on proper antibody validation. In this third and final article, see how you can use this information to publish meaningful data when using antibodies. And get some guidelines for antibody best practices.

The postFinding a Good Antibody：
部件III–Publish Meaningful Datafirst appeared onBioradiations.]]>

Finding New Horizons — What Possibilities Exist with Single-Cell Analysis?

Bioradiations Staff

Single-cell techniques offer exciting, new ways to understand personalized medicine and research. Developing these techniques at Bio-Rad is Dr. Kelly Kaihara, the third guest on Brilliant Science. Read about what makes single-cell analysis different and Kaihara’s perspective on its potential moving forward.

The postFinding New Horizons — What Possibilities Exist with Single-Cell Analysis?first appeared onBioradiations.]]>

Increase Yield and Reproducibility While Saving Time by Automating Recombinant Protein Purification

Bioradiations Staff

Presented by:Philip Chapman, MSc, Senior Global Product Manager

查看，查看

Learn how to quickly optimize conditions prior to automating a four-step purification of a histidine-tagged recombinant protein. Automating purification reduces a multi-day process into 12 hours while increasing yield and reproducibility.

The postIncrease Yield and Reproducibility While Saving Time by Automating Recombinant Protein Purificationfirst appeared onBioradiations.]]>

The Benefits of Flow Cytometry in Immuno-Oncology Research

Bioradiations Staff

Immuno-oncology, or cancer immunotherapy, research focuses heavily on the various types of cells and their behavior in cancer, so the use of flow cytometry to interrogate these cells is a no brainer. See how flow cytometry fits in this growing field of research and how it can help identify new targets and improve drug design to generate more effective and safer cancer therapeutics.

The postThe Benefits of Flow Cytometry in Immuno-Oncology Researchfirst appeared onBioradiations.]]>

Phagocytosis and Phasing Out Disease

Bioradiations Staff

Our immune systems could soon hold the key to rewriting disease and disorder treatments. Studying the inner workings of the immune system’s primary weapon, the macrophage, with the help of CRISPR is Dr. Adam Hoppe at SDSU. Read more about his exciting work and what he hopes to accomplish next.

The postPhagocytosis and Phasing Out Diseasefirst appeared onBioradiations.]]>

Improve Your Protein Purification Process Economy with CHT Ceramic Hydroxyapatite XT Media

Bioradiations Staff

CHT Ceramic Hydroxyapatite XT Media is designed for repeated use and exceptional resolution. It combines exceptional functionality with a long column life to help achieve high productivity and improved process economics. See how CHT XT can improve your protein purification.

The postImprove Your Protein Purification Process Economy with CHT Ceramic Hydroxyapatite XT Mediafirst appeared onBioradiations.]]>

Finding a Good Antibody:Part II — Antibody Validation

Bioradiations Staff

Finding antibodies that work for your application is just the first step in finding a good antibody. Next is antibody validation — making sure that your antibody does what you think it is supposed to. In this second article in our Finding a Good Antibody series, learn how best to go about validating your antibodies.

The postFinding a Good Antibody：
Part II-Antibody Validationfirst appeared onBioradiations.]]>

When Small Matters — See How the ZE5 Cell Analyzer Can Help

Bioradiations Staff

Presented by:Yasha Talaga, MSc, Applications and Collaborations Product Manager, Cell Biology

查看，查看

In this webinar, Yasha Talaga will explain how specific methodologies and instrument setup on the ZE5 Cell Analyzer allow for reliable exosome detection data.

The postWhen Small Matters — See How the ZE5 Cell Analyzer Can Helpfirst appeared onBioradiations.]]>

Best Practices for the Best Western Blots

Bioradiations Staff

Presented by:Paul Liu, PhD, Product Manager, Western Blot Reagents and Devices, Protein Quantitation Marketing
日期：Tuesday, July 10, 2018
Time:10 AM, U.S. Pacific time

Western blotting is an essential and ubiquitous method for protein research. We will discuss method optimization, data analysis best practices, and new advancements in imaging and fluorescent detection reagents that make western blot data more reproducible and quantitative.

The postBest Practices for the Best Western Blotsfirst appeared onBioradiations.]]>

The Potential for CRISPR Gene Editing in HIV

Bioradiations Staff

The advent of CRISPR as a gene editing tool appears to have revolutionized drug discovery and development in a very short time. CRISPR-Cas9 technology is also being utilized to target HIV, to mutate or cut out the provirus. Read about what’s new in potential treatments for HIV and the challenges facing the industry.

The postThe Potential for CRISPR Gene Editing in HIVfirst appeared onBioradiations.]]>

NYU Prof Harnesses CRISPR to End Muscular Dystrophy

Bioradiations Staff

On the scientific horizon are possibilities of curing genetic disorders and altering disease management — all because of CRISPR. Investigating exciting approaches to reversing the effects of muscular dystrophy with the help of CRISPR is Dr. Chengzu Long at NYU. Read more about his life, his work, and where he sees CRISPR going next.

The postNYU Prof Harnesses CRISPR to End Muscular Dystrophyfirst appeared onBioradiations.]]>

Finding a Good Antibody:Part I — Selecting the Best Antibodies

Bioradiations Staff

Even though antibodies are central to basic research as well as drug development and diagnostics, concerns with antibody validation remain high, and finding an antibody that works well for a specific application can be quite a challenge. Use these tips to select the best antibodies for your application.

The postFinding a Good Antibody：
Part I — Selecting the Best Antibodiesfirst appeared onBioradiations.]]>

Cancer in the Age of Long Noncoding RNA Discovery

Bioradiations Staff

Cancer is one of the leading causes of death in the world and, due to an aging population, more and more people are diagnosed with cancer every year. Researchers are actively searching for treatment options in the form of potential biomarkers. Long noncoding RNAs (lncRNAs) have piqued the interest of researchers as a relatively new source of therapeutics. Learn more about lncRNAs and see how they can be used in cancer diagnosis and intervention.

The postCancer in the Age of Long Noncoding RNA Discoveryfirst appeared onBioradiations.]]>

Improve the Quality of Your Cell Analysis with the ZE5™ Cell Analyzer

Bioradiations Staff

Cell analysis is a crucial first step in many experiments so a reliable, flexible, and quick cell analyzer that produces high-resolution, reproducible results is what every lab needs. See how the ZE5™ Cell Analyzer can help improve the quality of your cell analysis experiments, instill confidence in your results, and shorten the time to publish.

The postImprove the Quality of Your Cell Analysis with the ZE5™ Cell Analyzerfirst appeared onBioradiations.]]>

The How and Why of Normalizing Your Western Blots

Bioradiations Staff

Introducing data normalization into your western blotting workflow may sound unnecessary but it has proven to be a great way to ensure great results. Follow along as we break down some of the main takeaways from the first chapter in Dr. Oh’s popular wester blotting webinar series, including a unique method to ease normalization woes and worries.

The postThe How and Why of Normalizing Your Western Blotsfirst appeared onBioradiations.]]>

High-Throughput Single-Cell RNA-Seq of Large Cells and Nuclei

Bioradiations Staff

mRNA-FISH, single-cell RT-qPCR, and single-cell RNA sequencing (RNA-Seq) have emerged as popular single-cell transcriptomics technologies. See how the Illumina® Bio-Rad®Single-Cell Sequencing Solution overcomes many of the challenges of currently available platforms by allowing high-throughput and scalable sequencing of even the most challenging sample types, including large cells and small species such as nuclei.

The postHigh-Throughput Single-Cell RNA-Seq of Large Cells and Nucleifirst appeared onBioradiations.]]>

Bio-Plex® Multiplex Immunoassay Technology Overview and Setting Up to Run an Assay

Bioradiations Staff

Presented by:Brett Houser
日期：Tuesday, March 20, 2018
Time:9 AM, U.S. Pacific time

Multiplex immunoassays are an extremely powerful tool for protein detection and quantitation. In this webinar, get a general overview of multiplex immunoassay technology and tips on setting up experiments to optimize your results.

The postBio-Plex^®Multiplex Immunoassay Technology Overview and Setting Up to Run an Assayfirst appeared onBioradiations.]]>

The Ups and Downs of Biosimilar Development

Bioradiations Staff

In this podcast, biosimilar key opinion leader Dr. Paul Rhyne provides an overview of the current state of biosimilars and their global impact. Leveraging his 20+ years of experience in developing biologics, he discusses how cost and patient access play a big role in this new field of research.

The postThe Ups and Downs of Biosimilar Developmentfirst appeared onBioradiations.]]>

Preamplification and How it Can Be Used to Maximize qPCR Data Generation from Limited Samples

Bioradiations Staff

Incorporating preamplification into your qPCR experiments may seem daunting, but it is a powerful way to analyze targets from limited samples. The tips in this article will help you understand how preamplification can enhance your qPCR experiments and the considerations and implications for incorporating it into your workflow.

The postPreamplification and How it Can Be Used to Maximize qPCR Data Generation from Limited Samplesfirst appeared onBioradiations.]]>

Biosimilars：Providing More Treatment Options

Bioradiations Staff

It is hoped that the development of biosimilars will lead to more accessible and cost-effective treatment options. Here we explore the current opportunities for biosimilars in rheumatoid arthritis and discuss the opportunities and concerns tied to their use.

The postBiosimilars：Providing More Treatment Optionsfirst appeared onBioradiations.]]>

Introducing the NGC™ Fraction Collector for Discovery to Process-Scale Protein Purification

Bioradiations Staff

The newly launched NGC™ Fraction Collector, together with ChromLab™ 5.0 Software, have enhanced the functionality of the NGC Chromatography System to provide the flexibility and collection capacity needed for any application, from discovery to scale up. See how the NGC System can help you improve your protein purification process.

The postIntroducing the NGC™ Fraction Collector for Discovery to Process-Scale Protein Purificationfirst appeared onBioradiations.]]>

Generating Semi-Quantitative Western Blot Data Using Bio-Rad’s Image Lab™ 6.0 Software

Bioradiations Staff

Presented by: Kenneth J. Oh, PhD, Applications, Collaborations, and New Technology Manager, Protein Quantitation Marketing Group, Bio-Rad Laboratories, Inc.
Date: Tuesday, March 6, 2018

Western blotting is a popular tool for protein quantitation, and the advent of digital imaging has greatly increased the sensitivity, dynamic range, and quantitation limits of this technique. In the second webinar in this series, get step-to-step instructions for normalizing western blot data using Image Lab 6.0 Software.

The postGenerating Semi-Quantitative Western Blot Data UsingBio-Rad’s Image Lab™6.0 Softwarefirst appeared onBioradiations.]]>

What’s New in U.S. Biosimilar-Land?

Bioradiations Staff

Biosimilars are gaining in popularity and estimates predict that the U.S. could save between $40–250 billion in healthcare costs over the next decade by switching from biologics to biosimilars. See how biosimilars have gained in popularity recently, the challenges the U.S. faces in developing them, and what the future holds.

The postWhat’s New in U.S. Biosimilar-Land?first appeared onBioradiations.]]>

Minimizing On-Column Monoclonal Antibody Aggregate Formation

Bioradiations Staff

The formation of aggregates is a common but highly undesirable occurrence during monoclonal antibody purification. See how on-column aggregation is dependent on the type of resin used and how one particular high-resolution cation exchange resin allows for the lowest proportion of aggregate formation.

The postMinimizing On-Column Monoclonal Antibody Aggregate Formationfirst appeared onBioradiations.]]>

Identifying Predictive Biomarkers for Successful Immunotherapy Treatments

Bioradiations Staff

Find out how the S3e™ Cell Sorter can help scientists discover new biomarkers that have the potential to become new therapies for cancer and other diseases.

The postIdentifying Predictive Biomarkers for Successful Immunotherapy Treatmentsfirst appeared onBioradiations.]]>

Year in Review: What We Learned in 2017

Bioradiations Staff

In 2017,Bioradiationspublished a wide variety of general interest articles, tips, podcasts, and application notes. Revisit the technological advancements and growth in technology that researchers experienced this year. Here are the highlights of what we learned this year.

The postYear in Review: What We Learned in 2017first appeared onBioradiations.]]>

Top Five Podcasts of 2017

Bioradiations Staff

2017 saw the launch ofBioradiations’first-ever podcast! Here you can listen to the top five podcasts we published this year, and learn about a variety of topics from CRISPR gene editing to what biomarkers and biosimilars are.

The postTop Five Podcasts of 2017first appeared onBioradiations.]]>

Cell Sorting and Its Significance in Stem Cell Research

Bioradiations Staff

Stem cells possess the remarkable potential to self-renew and to differentiate into many different types of cells. Due to their unique ability to regenerate, they are being used in regenerative medicine and offer great hope for treating diseases such as diabetes and heart disease. However, since stem cells represent a rare population of cells, they are not always easy to study. See how the simplicity, efficiency, and flexibility of cell sorting is making it possible to isolate pure populations of stem cells for downstream analyses.

The postCell Sorting and Its Significance in Stem Cell Researchfirst appeared onBioradiations.]]>

Advances in Immunotherapy for Cancer

Bioradiations Staff

Cancer kills eight million people annually worldwide; this number will increase to 13 million by 2020. Lung, breast, colorectal, and prostate cancer are the four most commonly diagnosed cancers. Meaningful developments in immuno-oncology, or cancer immunotherapy, treatments are important now more than ever. Learn about some of the newer immunotherapies, including BiTE Antibodies and vaccines, and the companies developing them.

The postAdvances in Immunotherapy for Cancerfirst appeared onBioradiations.]]>

Apolipoproteins as Biomarkers in Heart Disease and Beyond

Bioradiations Staff

Apolipoproteins bind to lipids to form lipoproteins, which transport lipids throughout the lymphatic and circulatory systems. In addition to cardiovascular disease, apolipoproteins are now being linked to other diseases such as cancer, autoimmunity, and neurodegeneration. Learn more about the different types of apolipoproteins and see how they serve as biomarkers for these diseases.

The postApolipoproteins as Biomarkers in Heart Disease and Beyondfirst appeared onBioradiations.]]>

Western Blot Normalization Methods

Bioradiations Staff

Presented by: Kenneth J. Oh, PhD, Applications, Collaborations, and New Technology Manager, Protein Quantitation Marketing Group, Bio-Rad Laboratories, Inc.
Date: Tuesday, October 24, 2017

Western blotting continues to be a ubiquitous tool for the identification and quantitation of protein(s) of interest. The first webinar in this series will focus on common normalization techniques for quantitative western blotting and discuss important considerations when using these techniques.

The postWestern Blot Normalization Methodsfirst appeared onBioradiations.]]>

Immunotherapy: The Next Frontier for Cancer

Bioradiations Staff

Immunotherapy is not a new concept; it has, in fact, been around for more than 125 years. However, recent scientific advances have led to the emergence and rapid evolution of the field, especially immuno-oncology. Get an introduction to this exciting emerging field, learn about the different personalized therapies currently available, and see what the future of cancer immunotherapy looks like.

The postImmunotherapy: The Next Frontier for Cancerfirst appeared onBioradiations.]]>

Practical Experimental Design for Mixed-Mode Resins

Bioradiations Staff

Could you be missing opportunities to make the most of your time spent on protein chromatography experiments? Learn more about how Bio-Rad uses design of experiments (DoE) and our mixed-mode resin, Nuvia™ cPrime™, to optimize process-scale protein purification.

The postPractical Experimental Design for Mixed-Mode Resinsfirst appeared onBioradiations.]]>

Tips to Make Fluorophore Picking Easier

Bioradiations Staff

Fluorescence is a property of photo-excitable molecules that has been exploited to develop dyes, or fluorophores, that are used in a variety of experimental procedures, including western blotting. Learn more about the science behind fluorescent dyes and get some helpful tips on how to pick the right fluorophores for your experimental needs.

The postTips to Make Fluorophore Picking Easierfirst appeared onBioradiations.]]>

Speed Time to Results by Incorporating Flow Cytometry into the CRISPR‑Cas9 Gene Editing Workflow

Bioradiations Staff

The power to edit a gene is the power to change its function, and with it the biology of a cell. From generating novel cell lines and better animal models for the discovery and preclinical phases of therapeutic research to actually creating a therapeutic itself, CRISPR gene editing is allowing science to advance rapidly. See how enrichment and cell sorting can help generate edited cells faster and more reliably.

The postSpeed Time to Results by Incorporating Flow Cytometry into the CRISPR‑Cas9 Gene Editing Workflowfirst appeared onBioradiations.]]>

Discover the Technology behind Bio-Rad’s Custom Recombinant Antibodies

Bioradiations Staff

See inside Bio-Rad's custom antibody facility and learn how specific antibody requirements can become a reality through the use of Human Combinatorial Antibody Library (HuCAL®）technology for specialized custom antibodies。

The postDiscover the Technology behind Bio-Rad’s Custom Recombinant Antibodiesfirst appeared onBioradiations.]]>

The Importance of In Vitro Assays in the Development of Biosimilars

Bioradiations Staff

In this podcast, biosimilar expert, Amanda Turner, provides an in-depth explanation of the various in vitro assays used in biosimilar development and the importance of choosing the right assay type and components to achieve success.

The postThe Importance of In Vitro Assays in the Development of Biosimilarsfirst appeared onBioradiations.]]>

Understanding Biomarkers for Better Drug Discovery and Development

Bioradiations Staff

Biomarker intelligence comes from understanding the biomarker landscape, that is, the characteristics and features of biomarkers, and disease pathways. This understanding, in turn, helps to recognize the utility of biomarkers. In this study, we partnered with Amplion Inc., to investigate biomarker usage in 24 immunotherapy companies. We found the most popular biomarkers and learnt how they are being used by each company.

The postUnderstanding Biomarkers for Better Drug Discovery and Developmentfirst appeared onBioradiations.]]>

An IMAC Resin for a Highly Productive Histidine-Tagged Protein Purification Process

Bioradiations Staff

One of the advancements in protein purification has been to tag the protein of interest with a short sequence that can bind to an immobilized matrix and aid purification. Bio-Rad’s new IMAC resin offers a host of advantages for the purification of histidine-tagged proteins. Learn more about this resin and see how it can enhance the efficiency of your protein purification workflow.

The postAn IMAC Resin for a Highly Productive Histidine-Tagged Protein Purification Processfirst appeared onBioradiations.]]>

BrdU in Adult Neurogenesis Research

Bioradiations Staff

In this podcast, you will learn about the history of bromodeoxyuridine (BrdU) and how it was established as a popular tool for neurogenesis research. Gain insight into the latest BrdU-related findings and get five practical tips for controlling your BrdU labeling experiments.

The postBrdU in Adult Neurogenesis Researchfirst appeared onBioradiations.]]>

Biosimilars. Are They Ready for Primetime?

Bioradiations Staff

Is the hype surrounding biosimilars real or simply a hopeful view on an exceedingly expensive drug market? Read this article to find out more about biosimilars and understand the challenges facing the biosimilars industry.

The postBiosimilars. Are They Ready for Primetime?first appeared onBioradiations.]]>

Understanding the Eukaryotic Cell Cycle

Bioradiations Staff

The eukaryotic cell cycle is an evolutionarily conserved process that results in the replication of cells. Read this mini review to better understand the eukaryotic cell cycle and get an overview of common molecular techniques used to evaluate proliferating cells.

The postUnderstanding the Eukaryotic Cell Cyclefirst appeared onBioradiations.]]>

Why Biomarkers Are Important for Clinical Trial Success

Bioradiations Staff

In this podcast, learn more about biomarkers and their importance in clinical trials and how data-rich tools are being used to collect and curate the vast amounts of publicly available information about biomarkers.

The postWhy Biomarkers Are Important for Clinical Trial Successfirst appeared onBioradiations.]]>

Modern Improvements to Classic Technologies: Innovating Electrophoresis and Chromatography Upstream of Protein Characterization to Speed Up Research

Bioradiations Staff

When testing new drug therapies, it is essential to know the identity of the protein being tested. Chromatography is a commonly used technique to separate complex biological mixtures and isolate proteins of interest prior to downstream characterization. Learn more about how automating chromatography and stain-free technology are helping to save time and effort in protein purification.

The postModern Improvements to Classic Technologies: Innovating Electrophoresis and Chromatography Upstream of Protein Characterization to Speed Up Researchfirst appeared onBioradiations.]]>

Get More Answers from Your Mouse with the Bio-Plex Pro™ Mouse Chemokine Panel

Bioradiations Staff

Biomarker screening can sometimes be like working in a black box. While traditional research tools focus on one protein at a time, Bio-Rad’s new Bio-Plex Pro™ Mouse Chemokine Panel can simultaneously interrogate 33 chemokines and cytokines in a single well. See how you can get more answers with this panel.

The postGet More Answers from Your Mouse with the Bio-Plex Pro™ Mouse Chemokine Panelfirst appeared onBioradiations.]]>

CRISPR Gene Editing and Its Effect on Research and Development

Bioradiations Staff

Our resident gene editing expert, Dr. Yann Jouvenot, provides an overview of CRISPR gene editing and how it is affecting how research and development are being performed in the Biotech and Pharma industries.

The postCRISPR Gene Editing and Its Effect on Research and Developmentfirst appeared onBioradiations.]]>

Identify Major Immune Cell Types by Their CD Marker Expression

Bioradiations Staff

Our new immune cell lineage and marker database provides an interactive way to help you easily examine detailed marker data, view immune cell marker expression, and find the antibody to your marker. Learn more and try out the interactive tool for yourself.

The postIdentify Major Immune Cell Types by Their CD Marker Expressionfirst appeared onBioradiations.]]>

What Pharma Is Doing to Triple Clinical Trial Successes

Bioradiations Staff

The typical success rate of a clinical trial is less than ten percent. Pharmaceutical companies are using a variety of methods to save time and reduce costs to get drugs to market faster. Biomarker screening is proving to be an effective way to improve the drug discovery and development process. See one of the ways Pharma companies can identify the most relevant biomarkers.

The postWhat Pharma Is Doing to Triple Clinical Trial Successesfirst appeared onBioradiations.]]>

Validating Antibodies — the Good, the Bad, and the Necessary

Bioradiations Staff

Despite the fact that antibodies are one of the most frequently used tools in life science and clinical research, there are no universally accepted guidelines to ensure that they have been properly validated. Learn about the issues facing researchers and what antibody suppliers and researchers can do to ensure that the research being carried out is trustworthy and is helping to improve overall data quality.

The postValidating Antibodies — the Good, the Bad, and the Necessaryfirst appeared onBioradiations.]]>

Overview of the Four Main Gene Editing Techniques Used in Drug Discovery

Bioradiations Staff

Our resident gene editing expert, Dr. Yann Jounenvat, provides an overview of the four main gene editing techniques that are being used in life science research today. Learn about the pros and cons of each of method and where they are best applied.

The postOverview of the Four Main Gene Editing Techniques Used in Drug Discoveryfirst appeared onBioradiations.]]>

Key Steps to Ensure Optimized and Reproducible qPCR Experiments

Bioradiations Staff

Real-time PCR is a common and easy-to-adopt technology. By keeping a few simple steps in mind as you design and run your experiments you can ensure high-quality, reproducible data.

The postKey Steps to Ensure Optimized and Reproducible qPCR Experimentsfirst appeared onBioradiations.]]>

Rapid, Sensitive Cancer Biomarker Screening in cfDNA

Bioradiations Staff

Disease-associated mutations can be prognostic of outcome and inform treatment choices. However, traditional tissue biopsies limit the ability to implement personalized treatments. Read about how multiplex digital PCR can enable the tracking of treatment efficacy using liquid biopsies.

The postRapid, Sensitive Cancer Biomarker Screening in cfDNAfirst appeared onBioradiations.]]>

Erasing Disease: How Gene Editing is Changing Genetic Therapies

Bioradiations Staff

Gene augmentation and antisense therapies treat disease by providing a functional copy of faulty gene or repressing its expression. Find out how gene editing tools, like CRISPR, promise a more permanent cure.

The postErasing Disease: How Gene Editing is Changing Genetic Therapiesfirst appeared onBioradiations.]]>

Assessing Cell Health: Necroptosis

Bioradiations Staff

In this fourth and final part of the series on assessing the health of your cells, we review the different stages of necroptosis, see how it differs from apoptosis, and learn about the various methods of assessing cellular necroptosis.

The postAssessing Cell Health: Necroptosisfirst appeared onBioradiations.]]>

Investigating Immune Response Profiles Using Bio-Plex Pro™ Multiplex Assays

Bioradiations Staff

See how one study used Bio-Rad’s Bio-Plex Pro Human Cytokine 27-Plex Assay to investigate immune responses to an anti-viral compound in an effort to better understand vaccine efficacy.

The postInvestigating Immune Response Profiles Using Bio-Plex Pro™ Multiplex Assaysfirst appeared onBioradiations.]]>

Fluorescent Western Blotting: Helpful Tips for Optimizing Your Protocol

Bioradiations Staff

Western blotting using fluorescently tagged detection antibodies is a technique that is gaining in popularity. However, adopting a new technique can be challenging. Use the tips provided in this article to get started and see how fluorescent western blotting can enhance your scientific research.

The postFluorescent Western Blotting: Helpful Tips for Optimizing Your Protocolfirst appeared onBioradiations.]]>

The ZE5™ Cell Analyzer: Designed by Users for Users

Bioradiations Staff

Bio-Rad’s new ZE5 Cell Analyzer is a game-changing cell analyzer that was designed with direct input from scientists and flow core labs. Karen Helm runs the flow core facility at the University of Colorado Cancer Center and was one of the experts consulted. See how ZE5 is helping her flow core users do better science.

The postThe ZE5™ Cell Analyzer: Designed by Users for Usersfirst appeared onBioradiations.]]>

Characterization of Critical Reagents for Ligand Binding Assays

Bioradiations Staff

Ligand binding assays are utilized throughout the large-molecule drug development process. However, their robustness, accuracy, and reproducibility depend on the quality of critical reagents. See how you can ensure their consistent characterization, particularly during early drug development stages.

The postCharacterization of Critical Reagents for Ligand Binding Assaysfirst appeared onBioradiations.]]>

The Fluorescent Way: Why Start Fluorescent Western Blotting Now?

Bioradiations Staff

Find out why fluorescent western blotting is gaining in popularity and how it compares to more widely used methods, such as chemiluminescence. From easier multiplexing to brighter fluorophores to easier method development, learn about the many advantages of fluorescent western blotting.

The postThe Fluorescent Way: Why Start Fluorescent Western Blotting Now?first appeared onBioradiations.]]>

Multiplex Immunoassays: Five Tips for Optimizing Your Experiments

Bioradiations Staff

Follow the five tips in this article before embarking on your multiplex immunoassay journey to generate accurate, efficient, and biologically relevant results. From help designing experiments to acquiring accurate data, this article has it all.

The postMultiplex Immunoassays: Five Tips for Optimizing Your Experimentsfirst appeared onBioradiations.]]>

CRISPR: Changing the Pace of BioPharma R&D

Bioradiations Staff

Better model systems and faster, more comprehensive screens are only two of the many ways in which CRISPR is changing the pace of discovery. See how CRISPR is transforming research and development by providing us with tools that were once unimaginable.

The postCRISPR: Changing the Pace of BioPharma R&Dfirst appeared onBioradiations.]]>

Year in Review: Top Ten Articles of 2016

Bioradiations Staff

In 2016, we published a wide variety of general interest articles, customer testimonials, tips, protocols, videos, product highlight articles, and technical and application notes. Here are the ten articles you found the most interesting in 2016.

The postYear in Review: Top Ten Articles of 2016first appeared onBioradiations.]]>

The Making of Recombinant Anti-Idiotypic Antibodies For High Performance in Bioanalytical Assays

Bioradiations Staff

Discover how Bio-Rad develops highly specific, high-affinity recombinant monoclonal anti-idiotypic antibodies ideal for use in PK and ADA assays.

The postThe Making of Recombinant Anti-Idiotypic Antibodies For High Performance in Bioanalytical Assaysfirst appeared onBioradiations.]]>

Digital PCR: Helpful Tips When Using Droplet Partitioning Technology

Bioradiations Staff

Digital PCR offers a highly sensitive alternative to conventional qPCR, enabling absolute quantification of nucleic acids and rare allele detection. The tips in this article help you set up and optimize your digital PCR experiments when using droplet partitioning technology.

The postDigital PCR: Helpful Tips When Using Droplet Partitioning Technologyfirst appeared onBioradiations.]]>

Ten Tips for Improving Western Blot Detection of Immunoprecipitation Samples

Bioradiations Staff

Immunoprecipitation (IP) experiments and the detection of IP samples by western blotting can be quite challenging at times. The tips in this article help you set up and optimize your overall IP experimenta design.

The postTen Tips for Improving Western Blot Detection of Immunoprecipitation Samplesfirst appeared onBioradiations.]]>

TGX Stain-Free™ FastCast™ Acrylamide Gel Casting

Bioradiations Staff

This short video demonstrates how you can access the unique benefits of Bio-Rad's proprietary TGX Stain-Free Gel chemistry by hand casting your own TGX Stain-Free Gels in just a few quick and easy steps.

The postTGX Stain-Free™ FastCast™ Acrylamide Gel Castingfirst appeared onBioradiations.]]>

Parallel Analysis of RNA and Protein Expression Using SingleShot™ Cell Culture Lysates

Bioradiations Staff

Comprehensive and effective gene expression studies evaluate both transcriptional and translational regulation. A streamlined protocol was developed for the parallel analysis of mRNA and protein levels using a single lysate produced from cultured cells.

The postParallel Analysis of RNA and Protein Expression Using SingleShot™ Cell Culture Lysatesfirst appeared onBioradiations.]]>

Introduction to Algae Beads，Photosynthesis，and Cellular Respiration

Bioradiations Staff

Introduce students（and teachers）to the concepts of photosynthesis and cellular respiration in the context of howthese processes evolved and howthey affect our daily lives。

The postIntroduction to Algae Beads，Photosynthesis，and Cellular Respirationfirst appeared onBioradiations.]]>

Take Control of Your Flow Cytometry

Bioradiations Staff

Recommended for researchers with limited experience of flow cytometry.

The postTake Control of Your Flow Cytometryfirst appeared onBioradiations.]]>

Assessing Cell Health: Autophagy

Bioradiations Staff

Part III of our cell health series describes the three main autophagy mechanisms and reviews the various methods for assessing macroautophagy and autophagic flux in cells.

The postAssessing Cell Health: Autophagyfirst appeared onBioradiations.]]>

From Optimization to Automation: Multidimensional (Multi-D) Histidine-Tag Protein Purification

Bioradiations Staff

A well-designed multidimensional (Multi-D) chromatography process, which utilizes optimized individual column methods, can help automate multistep protein purification processes. This can help you save time and increase productivity. See how you can use Multi-D chromatography to expedite the purification of polyhistidine-tagged proteins when using a typical capture, intermediate, and polish purification workflow.

The postFrom Optimization to Automation: Multidimensional (Multi-D) Histidine-Tag Protein Purificationfirst appeared onBioradiations.]]>

Meet the Brightest ECL Substrate Around — Clarity Max™ Western ECL Substrate

Bioradiations Staff

See how our new high-sensitivity western ECL substrate, Clarity Max, can help you achieve greater western blotting success.

The postMeet the Brightest ECL Substrate Around — Clarity Max™ Western ECL Substratefirst appeared onBioradiations.]]>

From megaTALs to CRISPR: The Many Ways to Edit a Gene

Bioradiations Staff

CRISPR has revolutionized gene editing but is not the only way to edit a gene. We compare the pros and cons of four main gene editing techniques – meganucleases, zinc finger nucleases, TALENs, and CRISPR-Cas9 – discuss the advance of these methods to the clinic for therapeutic applications, and introduce newer technologies that eliminate some of the pitfalls of current techniques.

The postFrom megaTALs to CRISPR: The Many Ways to Edit a Genefirst appeared onBioradiations.]]>

Coupling Automated Chromatography with Faster Confirmation of Purity and Yield

Bioradiations Staff

We’ve combined the chromatography process with purity and yield assessment using stain-free gels to shorten and optimize your protein purification workflow. See how it’s done.

The postCoupling Automated Chromatography with Faster Confirmation of Purity and Yieldfirst appeared onBioradiations.]]>

Immunoprecipitation (IP) – Complex or Not?

Bioradiations Staff

Provides an overview of the IP process and hands-on-advice on how to design and control IP experiments.

The postImmunoprecipitation (IP) – Complex or Not?first appeared onBioradiations.]]>

Cleaning the Nozzle Tip on the S3e™ Cell Sorter

Bioradiations Staff

In this short video, we show how to clean the nozzle tip on the S3e Cell Sorter.

The postCleaning the Nozzle Tip on the S3e™ Cell Sorterfirst appeared onBioradiations.]]>

Monocytes — a Mini Review

Bioradiations Staff

Monocytes play key roles in mediating innate and adaptive immune responses. Here is an overview of the types, functions, process of recruitment, and the role of monocytes in disease.

The postMonocytes — a Mini Reviewfirst appeared onBioradiations.]]>

Six Tips for Efficient Transfer of Your Proteins

Bioradiations Staff

A good and complete transfer of proteins from gels to membranes is crucial for the success of western blotting. Here are six useful tips for successful transfer of proteins.

The postSix Tips for Efficient Transfer of Your Proteinsfirst appeared onBioradiations.]]>

Performing a Fluidics Hot Swap on the S3e™ Cell Sorter

Bioradiations Staff

In this video, we show how a fluidics hot swap can be performed without shutting down the S3e Cell Sorter.

The postPerforming a Fluidics Hot Swap on the S3e™ Cell Sorterfirst appeared onBioradiations.]]>

Cleaning the Streams Camera Window on the S3e™ Cell Sorter

Bioradiations Staff

In this video we show you how to clean the camera streams window as part of routine maintenance for your S3e Cell Sorter.

The postCleaning the Streams Camera Window on the S3e™ Cell Sorterfirst appeared onBioradiations.]]>

Productivity through Workflow Personalization: What Pharma Is Learning from Other Industries

Bioradiations Staff

Striving for efficiency in workflow is not a new concept. Automation and use of smart technologies in industries such as automotive and shipping, and services like USPS and UPS, have drastically changed the way they function today not just with innovation but with personalization. Pharma is beginning to understand the need for adopting personalized workflow as well. Now, what can Pharma learn from these industries and how can it apply it to the industry?

The postProductivity through Workflow Personalization: What Pharma Is Learning from Other Industriesfirst appeared onBioradiations.]]>

Attaching a Dynaloop to the NGC™ Chromatography System

Bioradiations Staff

This video describes the three main steps in attaching a DynaLoop Sample Loop to the NGC™ Chromatography System to enable the injection of larger sample volumes: connecting the DynaLoop Sample Loop to the NGC Chromatography System, priming the DynaLoop Sample Loop, and creating a method in ChromLab™ Software.

The postAttaching a Dynaloop to the NGC™ Chromatography Systemfirst appeared onBioradiations.]]>

Calibrating the pH Valve on the NGC™ Chromatography System

Bioradiations Staff

The NGC pH valve provides real-time, in-line monitoring of buffer pH. In this video, you’ll learn how to connect the pH valve to the NGC System, add it to the flow path, and calibrate the valve using buffers at two different pH values. Features of the pH valve include accessible calibration ports and easy bypass of the probe when the NGC System is being cleaned.

The postCalibrating the pH Valve on the NGC™ Chromatography Systemfirst appeared onBioradiations.]]>

Tips and Strategies for Successful Purification of Your Proteins

Bioradiations Staff

A biomolecule protein purification workflow requires more than one resin. The trick is to find the combination of resins that provides the highest purity in the least number of steps and at the lowest cost. Here are some guides to select the optimal resins for the purification of monoclonal antibodies, native and recombinant proteins, Ig G and mammalian and adenovirus, and for removing aggregates and endotoxins.

The postTips and Strategies for Successful Purification of Your Proteinsfirst appeared onBioradiations.]]>

Apoptosis

Bioradiations Staff

Differentiating between healthy and apoptic cells.

The postApoptosisfirst appeared onBioradiations.]]>

Mastering IHC Staining Experiments

Bioradiations Staff

Best practice for sample preparation, staining, and analysis.

The postMastering IHC Staining Experimentsfirst appeared onBioradiations.]]>

Optimize Your Flow Cytometry

Bioradiations Staff

Best practice for sample preparation, staining, and analysis.

The postOptimize Your Flow Cytometryfirst appeared onBioradiations.]]>

Cats Make Logical Inferences

Bioradiations Staff

People who live with cats attribute a lot of calculating behaviors to them. If this includes thinking your cat has a fundamental grasp of cause and effect, then you’re backed up by recent research by Saho Takagi and colleagues at Kyoto University.

The postCats Make Logical Inferencesfirst appeared onBioradiations.]]>

Assessing Cell Health: Apoptosis

Bioradiations Staff

In this second part of the series on assessing the health of your cells, we review the different types and stages of apoptosis, and the various methods of assessing apoptosis of cells.

The postAssessing Cell Health: Apoptosisfirst appeared onBioradiations.]]>

Macrophage Polarization — An Overview

Bioradiations Staff

Macrophages are important players in the phagocytosis process in the immune system. In this detailed review, we provide an overview on the different types of macrophages, the signaling molecules involved in the polarization of M1 and M2 macrophage subsets, and more.

The postMacrophage Polarization — An Overviewfirst appeared onBioradiations.]]>

Recombinant Proteins-A Success Story Synthesis and Purification of Recombinant Proteins-A Success Story

Bioradiations Staff

Producing highly purified proteins in large quantities is a challenge and requires modification of methods and protocols to attain high efficiency. Dr Murat Kasap from Kocaeli University, Turkey, has overcome these difficulties by taking advantage of the modularity of the NGC Chromatography System and successfully synthesized and purified cardiac troponin-I protein.

The postRecombinant Proteins-A Success Story Synthesis and Purification of Recombinant Proteins-A Success Storyfirst appeared onBioradiations.]]>

Removing Air Bubbles from the NGC™ Chromatography System

Bioradiations Staff

This video explains how to remove bubbles and/or reduce bubble formation in your NGC System. Tips to reduce bubbles include warming up your multiwave detector for 30 to 60 min before use and flowing buffer at 0.1–0.2 ml/min in the manual mode until a stable/flat baseline is achieved before starting a method. The system may also be flushed with 100% methanol or ethanol at purge speed, with columns out of line, to remove bubbles.

The postRemoving Air Bubbles from the NGC™ Chromatography Systemfirst appeared onBioradiations.]]>

Using the Air Sensor on the NGC™ Chromatography System

Bioradiations Staff

This video describes the functions of the Air Sensor Module and how to connect it to the NGC Chromatography System. The NGC Air Sensor senses the end of sample or buffer and prevents the introduction of air into the system, which can damage columns and/or incur the loss of precious samples. Both small and large air sensors are available to fit the tubing being used. Steps for connecting the Air Sensor Module and associated air sensors are described including how to add the air sensors into the system flow path using ChromLab™ Software and the differences in using the air sensors in manual vs. method modes.

The postUsing the Air Sensor on the NGC™ Chromatography Systemfirst appeared onBioradiations.]]>

Teach Your Hatchlings Well

Bioradiations Staff

Baby songbirds learn their songs more quickly if their adult-bird teachers use baby talk, says research from Jon Sakata and colleagues at McGill University. Baby zebra finches learned songs significantly faster when taught by adult birds, as opposed to recordings of birds, and the team found that the reason was that real birds altered their songs in ways similar to human adults talking to small children, slowing and repeating phrases.

The postTeach Your Hatchlings Wellfirst appeared onBioradiations.]]>

A Superior Method for Parallel Analysis of RNA and Protein Expression from Cell Culture Lysates

Bioradiations Staff

It is imperative to analyze both the transcriptional and translational profiles for a complete understanding of the functioning of genes. Here we describe a simple protocol that enables parallel analysis of both RNA and protein from single cell culture lysates. See how this workflow could save time and money and yield more reliable data than the traditional protocols used.

The postA Superior Method for Parallel Analysis of RNA and Protein Expression from Cell Culture Lysatesfirst appeared onBioradiations.]]>

Assessing Cell Health: Viability and Proliferation

Bioradiations Staff

In this multi-part series on assessing the health of your cells, we review different factors to be considered in your assessments such as cell viability, proliferation, apoptosis, and autophagy. The first part covers the methods for assessing viability and proliferation and their advantages, and discusses some common considerations.

The postAssessing Cell Health: Viability and Proliferationfirst appeared onBioradiations.]]>

Purifying Difficult-to-Purify Proteins

Bioradiations Staff

Protein purification becomes a challenging step for applications requiring high protein concentrations (such as structural biology studies). This is also true for researchers purifying integral membranes proteins and untagged proteins from native sources. Here we provide some useful tips for selecting the proper resins, optimizing conditions and developing effective strategies to tackle the challenges associated with such difficult-to-purify proteins.

The postPurifying Difficult-to-Purify Proteinsfirst appeared onBioradiations.]]>

Tips for Selecting the Best Gel for Your Application

Bioradiations Staff

Picking the right gel for your application is not easy. It depends on so many factors, such as the purpose of your application, the size of your protein, what kind of buffer you need to have in your sample etc. Here we provide a guide for you to choose the best Bio-Rad gel based on all these factors.

The postTips for Selecting the Best Gel for Your Applicationfirst appeared onBioradiations.]]>

Research Review: Phasing Genomes using Droplet Digital™ PCR

Bioradiations Staff

Find out how a new Droplet Digital PCR-based technique called Drop Phase lets you quickly and easily phase genomes to better understand diseases like cystic fibrosis.

The postResearch Review: Phasing Genomes using
Droplet Digital™ PCRfirst appeared onBioradiations.]]>

Birds of a Feather Flock According to Weather?

Bioradiations Staff

Polymorphic animals are those that have distinctly different outward traits, such as a color, within a species. Black sparrowhawks (Accipiter melanoleucus)），despite their common name, exist in a version with a white front as well as an all-dark version. But why would evolution simultaneously favor such contrasting color variations within the species?

The postBirds of a Feather Flock According to Weather?first appeared onBioradiations.]]>

Bioradiations May 2016 Edition

Bioradiations Staff

See what new articles and videos are in the May edition of Bioradiations.

The postBioradiations May 2016 Editionfirst appeared onBioradiations.]]>

Rapid Advances in Biotechnology Bring Questions about Patentability

Bioradiations Staff

Striking a balance between encouraging innovation and allowing access to knowledge is not simple. Allowing patents for modifications of naturally occurring organisms and cells pose a particular challenge to the scientific community. Adding to the complexity is the variations in regulations between countries. This article discusses these issues with specific examples in biotechnology and biomedical fields.

The postRapid Advances in Biotechnology Bring Questions about Patentabilityfirst appeared onBioradiations.]]>

The Importance of Quality PCR Plastics

Bioradiations Staff

Do we ever think seriously about PCR plates, seals, and tubes as contributing to the quality of our gene expression results? Chances are that these PCR plastics are viewed just as labware by most people. In this article we bring out how simple factors, such as PCR plate rigidity, color of the wells, and adhesiveness of plate seals, can affect your gene expression results and show why it is important to use quality PCR plastics.

The postThe Importance of Quality PCR Plasticsfirst appeared onBioradiations.]]>

How Do You Automate a Multicolumn Protein Purification?

Bioradiations Staff

Multicolumn purifications are tedious and the manual operations during this process introduce variabilities, affecting the success of purification and reproducibility of results. This whiteboard animation explains how an automated multi-dimensional chromatography method can make this an easier process with very high success rates.

The postHow Do You Automate a Multicolumn Protein Purification?first appeared onBioradiations.]]>

#5 General Tips to Make your Multiplex Experiments Easier

Bioradiations Staff

Here are some general tips to make your multiplex immunoassay experiments successful.

The post#5 General Tips to Make your Multiplex Experiments Easierfirst appeared onBioradiations.]]>

Are You Vegetarian? Could Be Something in Your Genes

Bioradiations Staff

A recent study published inMolecular Biology and Evolutiondescribes a phenomenon where populations that have typically consumed vegetarian diets over hundreds of generations have evolved a “vegetarian gene”.

The postAre You Vegetarian? Could Be Something in Your Genesfirst appeared onBioradiations.]]>

Do Lizards Dream of Scaly Sheep?

Bioradiations Staff

If you rouse a sleeping dragon, you might be interrupting its dreams. Or at least that’s the suggestion from recent studies at the Max Planck Institute for Brain Research. A team led by Gilles Laurent set out to learn how the Australian dragon (Pogona vitticeps) responds to visual information, but continuous monitoring of brain activity with electrodes revealed other intriguing data. When sleeping, the reptiles’ brains emitted alternating patterns that resembled the switching between slow-wave deep sleep and rapid eye movement (REM) observed in birds and mammals, including humans. The alternation in reptile brains was quicker and more regular than in birds and mammals, but otherwise comparable. The team made additional observations that bolstered their suspicion that the lizards were experiencing REM, and they discovered additional similarities to mammal and bird sleep, such as coordination between regions of the brain.

The postDo Lizards Dream of Scaly Sheep?first appeared onBioradiations.]]>

Overcoming Purification Hurdles with Mixed-Mode Chromatography

Bioradiations Staff

Dr. Mark Snyder, a leading expert in the field of protein purification, presents the purification process development for two very different targets, adenovirus and bacterial surface proteins. In both cases, a two-step column process results in a preparation with high yield and activity and very low host cell protein and DNA contamination. Conditions used make the methods suitable for large-scale production. In this webinar you will learn about: Advantages of mixed-mode resins Optimizing purification process development Procedures for purifying adenovirus and bacterial surface proteins

The postOvercoming Purification Hurdles with Mixed-Mode Chromatographyfirst appeared onBioradiations.]]>

#4 Steps to a Successful Cell and Tissue Homogenates Prep for Multiplex Assays

Bioradiations Staff

Explore this protocol for cell and tissue homogenate prep for multiplex assays.

The post#4 Steps to a Successful Cell and Tissue Homogenates Prep for Multiplex Assaysfirst appeared onBioradiations.]]>

Expanding Flow Core Capabilities with the S3e™ Cell Sorter

Bioradiations Staff

Andy Riddell, Flow Cytometry Core Facility Manager at the Wellcome Trust- MRC Stem Cell Institutes, is expanding his core facility by allowing his researchers to conduct sorting on their own. In doing so, he is now free to explore and answer the challenging flow cytometry questions that require more of his expert time. Find out how the S3e Cell Sorter has allowed Andy that freedom and how easy sorting can be for researchers.

The postExpanding Flow Core Capabilities with the S3e™ Cell Sorterfirst appeared onBioradiations.]]>

Ravens Get Inside Each Other’s Heads

Bioradiations Staff

New research suggests that ravens understand that others have minds. Theory of mind, the ability to attribute perceptions and mental states to others, either like or different from one’s own, has previously been assumed to be the domain of humans only.

The postRavens Get Inside Each Other’s Headsfirst appeared onBioradiations.]]>

Bioradiations April 2016 Edition

Bioradiations Staff

See what new articles and videos are in the April edition of Bioradiations.

The postBioradiations April 2016 Editionfirst appeared onBioradiations.]]>

扩展Flow Core Capabilities by Shifting Routine Sorts to Self-Sort on the S3e™Cell Sorter

Bioradiations Staff

To run a core flow cytometry lab is no easy task. There is always a balance between running simple sorts and developing new assays for answering complicated questions that demand pushing the limits of existing assays and the limitations of the sorters. See how Andy Riddell, a flow core manager, pushes the limits of his existing assays and how Bio-Rad’s S3e™ cell sorter is allowing him to accomplish that.

The post扩展Flow Core Capabilities by Shifting Routine Sorts to Self-Sort on the S3e™Cell Sorterfirst appeared onBioradiations.]]>

Western Blot Detection without Interfering IgGs: A Mere Fantasy or a Real Possibility?

Bioradiations Staff

Interference from IgG heavy (~ 50 kD) or light (~25 kD) chains is very common when trying to visualize bands of immunoprecipitated proteins. If your band of interest has a molecular weight close to these, it becomes really hard to distinguish between the IgG and the band of interest. How could this be avoided? Bio-Rad’s new TidyBlot™ Western Blot Detection Reagent accomplishes this by binding exclusively to the native nondenatured antibodies rather than any IgG in the sample. Explore the performance characteristics of this new reagent.

The postWestern Blot Detection without Interfering IgGs: A Mere Fantasy or a Real Possibility?first appeared onBioradiations.]]>

Characterizing Functional Domains of Potential Therapeutics with Better Protein Purification

Bioradiations Staff

Dr. John Bruning (University of Adelaide) and Dr. Jiansheng Wu (Genentech), two leading experts in the field of protein purification, share exciting examples of their research and recent chromatography tools they have used to demonstrate robust and improved efficiencies to their discovery and characterization protein purification workflows.

The postCharacterizing Functional Domains of Potential Therapeutics with Better Protein Purificationfirst appeared onBioradiations.]]>

Bioradiations March 2016 Edition

Bioradiations Staff

See what new articles and videos are in the March edition of Bioradiations.

The postBioradiations March 2016 Editionfirst appeared onBioradiations.]]>

Using PrimePCR™ Gene Expression Assays to Understand Breast Cancer Metastasis

Bioradiations Staff

Tumor metastasis is a complex process. It requires the ability of the cancer cells to invade their surroundings and travel to distant sites and survive. Dr. Traci Lyons studies the mechanism of COX-2 functioning in the metastasis of breast cancer cells. Find out how Dr. Lyons used Bio-Rad’s PrimePCR™ Assays to confirm COX-2 knockdown at the mRNA level.

The postUsing PrimePCR™ Gene Expression Assays to Understand Breast Cancer Metastasisfirst appeared onBioradiations.]]>

8 Tips for Understanding Multiplex Immunoassay Development and Validation

Bioradiations Staff

Multiplex immunoassay development requires a lot of validation and standardization steps. Several factors can influence the performance of these assays. Some factors that need to be considered are mentioned here.

The post8 Tips for Understanding Multiplex Immunoassay Development and Validationfirst appeared onBioradiations.]]>

How Does an Antibody Qualify To Become a PrecisionAb™ Antibody?

Bioradiations Staff

Not all antibodies are created equal. Some have to work hard to qualify to become Bio-Rad’s PrecisionAb™ Antibody. Here is a diagrammatic representation of how the qualification criteria are determined.

The postHow Does an Antibody Qualify To Become a PrecisionAb™ Antibody?first appeared onBioradiations.]]>

Mixed-Mode Chromatography for mAb S Aggregate Removal: Comparison of CHT™ Ceramic Hydroxyapatite, Capto adhere, and Capto adhere ImpRes

Bioradiations Staff

The separation of monomers from product-related impurities is quite challenging in process separations. It requires a thorough screening and an efficient resin to get efficiency in the purification process. Review the performance data of Bio-Rad’s mixed mode CHT™ Ceramic Hydroxapatite in achieving process separation efficiency and how it compares with various Capto media.

The postMixed-Mode Chromatography for mAb S Aggregate Removal: Comparison of CHT™ Ceramic Hydroxyapatite, Capto adhere, and Capto adhere ImpResfirst appeared onBioradiations.]]>

#3 Steps to a Successful Cell Culture Supernatant Prep for Multiplex Immunoassays

Bioradiations Staff

Here is a quick protocol for preparing a cell culture supernatant sample for multiplex biomarker analysis.

The post#3 Steps to a Successful Cell Culture Supernatant Prep for Multiplex Immunoassaysfirst appeared onBioradiations.]]>

Using PrimePCR™ qPCR Assays to Understand Breast Cancer Metastasis

Bioradiations Staff

Traci Lyons describes how PrimePCR Assays ended her laboratory’s struggle to find a qPCR assay that could reliably detect transcription of the cyclooxygenase-2 (Cox-2) gene, which they had identified as potentially prometastatic. Using the PrimePCR Assay for Cox-2, researchers in her lab were finally able to verify cyclooxygenase-2 knockdown, which is a necessary step toward confirming its role in breast cancer metastasis.

The postUsing PrimePCR™ qPCR Assays to Understand Breast Cancer Metastasisfirst appeared onBioradiations.]]>

A New Source for Mutations Found in Tumors

Bioradiations Staff

A study recently published in theProceedings of the National Academy of Sciencesfurthers our understanding of tumors and the source of the mutations that are found within their DNA. This study, carried out by researchers at Wayne State University and Indiana University, highlights a new mutation signature found in cancer cells that is caused by members of the APOBEC3 family of proteins.

The postA New Source for Mutations Found in Tumorsfirst appeared onBioradiations.]]>

Using Sound Waves as Tweezers to Move Single Cells

Bioradiations Staff

A single enzyme, ribonucleotide reductase (RNR), is responsible for making all four deoxyribonucleotides (dNTPs) and ensuring that they are present at the ratios required to synthesize new DNA. This is possible because RNRs change their substrate specificity in response to dNTP abundance. For example, when dGTP is abundant it binds RNR, increase its affinity for ADP, and thus shifts synthesis to dATP. Scientists in the Drennan lab at the Massachusetts Institute of Technology have long been fascinated by this unusual enzyme and now describe the allosteric changes that underlie RNR’s ability to shift specificity and maintain the proper dNTP pool in our cells.

The postUsing Sound Waves as Tweezers to Move Single Cellsfirst appeared onBioradiations.]]>

Bat Signal Precision

Bioradiations Staff

Imagine you’re singing the Batman theme song in a large chorus and you need to identify your own voice in the playback. Sounds difficult, but it is similar to what individual bats in colonies must do to navigate and find tiny morsels of food such as insects via echolocation. New research from a team at Tel Aviv University led by Yossi Yovel indicates they do this by modifying the volume and duration of the calls and then following the echo that exactly matches. If you did this in your chorus, you’d pick out your own voice by knowing whether you were singing “batman,” “batmaan,” or “batmaaan.” The finding dispels the previous assumption that the bats were modifying the pitch of their voices.

The postBat Signal Precisionfirst appeared onBioradiations.]]>

Bioradiations February 2016 Edition

Bioradiations Staff

See what new articles and videos are in the February edition of Bioradiations.

The postBioradiations February 2016 Editionfirst appeared onBioradiations.]]>

New Product Feature: gDNA-Free cDNA in Two Simple Steps

Bioradiations Staff

Removing genomic DNA contamination from cDNA preparations is a challenge. All currently available methods are time consuming, could lead to sample loss, and are not efficient. Bio-Rad’s iScript™gDNA Clear cDNA Synthesis Kit tackles these issues and makes this step effortless. This article presents the performance data of the kit and describes how simple and efficient it is to use the kit for gDNA removal.

The postNew Product Feature: gDNA-Free cDNA in Two Simple Stepsfirst appeared onBioradiations.]]>

PrecisionAb™ Antibodies: Defining New Standards for Western Blotting

Bioradiations Staff

Choosing the right primary antibody is an arduous task. A lot of standardization needs to happen before we can determine that the antibody is specific and sensitive enough for the purpose of our experiment. The new PrecisonAb™ Antibodies from Bio-Rad go through vigorous testing and validation before they are deemed suitable, thus eliminating the process of trial and error for researchers. The video describes how the PrecisionAb antibodies are developed.

The postPrecisionAb™ Antibodies: Defining New Standards for Western Blottingfirst appeared onBioradiations.]]>

How Does the Mixed Mode Interaction of a Media Help Achieve High Selectivity and Resolution?

Bioradiations Staff

The best chromatography media should yield high protein purity and product recovery as well as be versatile enough to purify difficult samples. Bio-Rad’s CHT™ Ceramic Hydroxyapatite achieves this by virtue of being able to interact with the proteins through multiple modes, making the process extremely efficient. The whiteboard animation describes the mode of action of CHT.

The postHow Does the Mixed Mode Interaction of a Media Help Achieve High Selectivity and Resolution?first appeared onBioradiations.]]>

Map of Human Lineage Biomarkers for Different Immune Cell Types

Bioradiations Staff

How can we easily identify biomarkers for different immune cell types? Refer to this color-coded poster for quick and simple identification of human lineage biomarkers.

The postMap of Human Lineage Biomarkers for Different Immune Cell Typesfirst appeared onBioradiations.]]>

Western Blotting without Trial and Error: Use PrecisionAb™ Antibodies

Bioradiations Staff

Watch this video to see how PrecisionAb Validated Western Blotting Antibodies are defining a new standard of quality that you can trust to deliver superior results and reproducibility in western blotting.

The postWestern Blotting without Trial and Error: Use PrecisionAb™ Antibodiesfirst appeared onBioradiations.]]>

#2 Steps for a Successful Serum or Plasma Preparations for Multiplex Biomarker Assays

Bioradiations Staff

Here is a quick protocol for preparing a serum or plasma sample for multiplex biomarker analysis.

The post#2 Steps for a Successful Serum or Plasma Preparations for Multiplex Biomarker Assaysfirst appeared onBioradiations.]]>

Study Explains How One Enzyme Can Synthesize All Four DNA Bases

Bioradiations Staff

The postStudy Explains How One Enzyme Can Synthesize All Four DNA Basesfirst appeared onBioradiations.]]>

The Beginning of the End for Ebola?

Bioradiations Staff

Researchers at Albert Einstein College of Medicine and the US Army Medical Research Institute of Infectious Diseases have discovered a potential immunotherapeutic treatment for two of the deadliest Ebola virus strains.

The postThe Beginning of the End for Ebola?first appeared onBioradiations.]]>

Design for Learning: Developing Curricula for Instructional Lab Kits

Bioradiations Staff

How are educational curricula developed? Who sets the standards? How do companies that develop science education kits keep up with this and design their kits around the curricula? Find out in this article.

The postDesign for Learning: Developing Curricula for Instructional Lab Kitsfirst appeared onBioradiations.]]>

List of Mouse Lineage Biomarkers for Different Immune Cell Types

Bioradiations Staff

How can we easily identify biomarkers for different immune cell types? This color-coded poster makes identification of mouse lineage biomarkers easy.

The postList of Mouse Lineage Biomarkers for Different Immune Cell Typesfirst appeared onBioradiations.]]>

Chromatography: Everything You Need to Know about Your Peaks

Bioradiations Staff

What can chromatography peaks tell us? From the quality of column packing to the purity of separated proteins, a lot can be gleaned from the peaks. Here are some definitions that can help decipher what chromatography peaks can tell us.

The postChromatography: Everything You Need to Know about Your Peaksfirst appeared onBioradiations.]]>

How to Design Hydrolysis Probes for qPCR

Bioradiations Staff

What's the optimal melting temperature for a hydrolysis probe? How long should your probe be? And why should you avoid 5' guanines like the plague? This episode answers these questions and gives you five simple tricks for designing the perfect hydrolysis probe.

The postHow to Design Hydrolysis Probes for qPCRfirst appeared onBioradiations.]]>

#1 May the Plex Be with You — Serum or Plasma: What Sample Do I Choose for My Multiplex Biomarker Assays?

Bioradiations Staff

Find out why your multiplex assay measurements can differ for serum and plasma samples.

The post#1 May the Plex Be with You — Serum or Plasma: What Sample Do I Choose for My Multiplex Biomarker Assays?first appeared onBioradiations.]]>

A Pain-Free Life: How Some People Are Unable to Feel Pain

Bioradiations Staff

Individuals born with a rare gene mutation that leads to a nonfunctional sodium channel Nav1.7 are unable to feel pain. Although previous attempts to develop an analgesic drug by blocking Nav1.7 have been largely unsuccessful, researchers at University College London discovered recently that Nav1.7-deficient humans and transgenic mice had elevated levels of opioid peptides. These opioids likely contribute to the painlessness and elucidate a potential analgesic approach that combines specific sodium channel blockade with a low dose of opioids.

The postA Pain-Free Life: How Some People Are Unable to Feel Painfirst appeared onBioradiations.]]>

CRISPR-Cas9 Makes Studying Exotic Organisms Much Easier

Bioradiations Staff

The CRISPR-Cas9 system has been making major waves in the field of gene editing for some time now. Now, researchers at the University of California, Berkeley have shown that not only is this gene-editing tool transforming the field of basic science research, but it can have a great impact on genetic studies in more exotic organisms like slime mold and octopi.

The postCRISPR-Cas9 Makes Studying Exotic Organisms Much Easierfirst appeared onBioradiations.]]>

Making CRISPR-Targeted Genome Editing Safer

Bioradiations Staff

The CRISPR-Cas9 technology is a powerful system for genome editing. It works by making targeted modifications to DNA. Guided by short RNAs known as CRISPR RNA or crRNA, the Cas9 protein is targeted to a specific sequence that is complementary to the crRNA sequence. Cas9 is highly efficient at cleaving at its target site. However, off-target cleavage, that is, binding to and cutting sites that are not fully complementary to the guide RNA, is a major drawback of the system.

The postMaking CRISPR-Targeted Genome Editing Saferfirst appeared onBioradiations.]]>

Bioradiations January Edition

Bioradiations Staff

See what new articles and videos are in the January edition of Bioradiations.

The postBioradiations January Editionfirst appeared onBioradiations.]]>

So, How Can the Sso7d Fusion Polymerase Technology Help Your PCR?

Bioradiations Staff

During a PCR reaction, it is imperative for the DNA polymerase to remain attached to the template while extending the new strand. This association is jeopardized under challenging PCR conditions and when amplifying longer DNA fragments. See how Sso7d, a small protein capable of binding with the polymerase, helps in stabilizing this association and increasing PCR efficiency.

The postSo, How Can the Sso7d Fusion Polymerase Technology Help Your PCR?first appeared onBioradiations.]]>

Flow Cytometry: Basic Definitions

Bioradiations Staff

It’s always good to get the basics straight. Here, we’ve defined some flow cytometry terms that might have eluded you.

The postFlow Cytometry: Basic Definitionsfirst appeared onBioradiations.]]>

#7 How Do You Detect DNA Contamination in Your Protein During Purification?

Bioradiations Staff

Here are some ways you can detect DNA contamination during the protein purification process.

The post#7 How Do You Detect DNA Contamination in Your Protein During Purification?first appeared onBioradiations.]]>

Six Tips for Increasing the Reproducibility of qPCR Experiments

Bioradiations Staff

Follow these six simple tips and you'll increase the reproducibility of your qPCR experiments.

The postSix Tips for Increasing the Reproducibility of qPCR Experimentsfirst appeared onBioradiations.]]>

High-Processivity Sso7d Fusion Polymerase Improves qPCR Results

Bioradiations Staff

Processivity is the rate at which nucleotides are added to extend PCR products. High processivity results in a greater number of nucleotides incorporated in each polymerase binding event.

The postHigh-Processivity Sso7d Fusion Polymerase Improves qPCR Resultsfirst appeared onBioradiations.]]>

Making CRISPR-Targeted Genome Editing Safer

Bioradiations Staff

The postMaking CRISPR-Targeted Genome Editing Saferfirst appeared onBioradiations.]]>

A Sticky Plant with a Clever Trick

Bioradiations Staff

A garden book might note a columbine’s delicate leaves and gracefully nodding flowers, but at least one species,Aquilegia eximia单击功能区上，has been shown to have a trick or two up its sepal.

The postA Sticky Plant with a Clever Trickfirst appeared onBioradiations.]]>

What Day to Schedule Esophageal Cancer Surgery?

Bioradiations Staff

If you’re undergoing surgery for esophageal cancer, you may want to schedule it for a Monday or Tuesday. Researchers at the Karolinska Institutet in Stockholm, Sweden found that patients who undergo esophageal cancer surgery early in the week have a greater chance of long-term survival than those who have surgery at the end of the week. These findings were recently published in the journalAnnals of Surgery。

The postWhat Day to Schedule Esophageal Cancer Surgery?first appeared onBioradiations.]]>

Trained Pigeons Read Mammograms As Well As Humans

Bioradiations Staff

Contrary to conventional belief, having a “bird brain” may not be a bad thing — at least for identifying cancer on radiology images. A recent study from the University of Iowa and the University of California (UC) Davis, showed that trained pigeons performed as well as humans in identifying benign and malignant breast tissue on digitized slides and mammograms. The results help elucidate how physicians process visual cues on diagnostic images and highlight pigeons’ ability to interpret complex visual images.

The postTrained Pigeons Read Mammograms As Well As Humansfirst appeared onBioradiations.]]>

Bioradiations December Edition

Bioradiations Staff

See what new articles and videos are in the November edition of Bioradiations.

The postBioradiations December Editionfirst appeared onBioradiations.]]>

Bioradiations November Edition

Bioradiations Staff

See what new articles and videos are in the November edition of Bioradiations.

The postBioradiations November Editionfirst appeared onBioradiations.]]>

Bio-Rad’s PrimePCR™ Assays and Panels Eliminate Multiple Steps from Your qPCR Workflow

Bioradiations Staff

A qPCR workflow involves multiple steps, each of which adds to the time and cost of the entire experiment. The PrimePCR™ Assays and Panels from Bio-Rad eliminate a number of these steps with their predesigned primers and probes and help with the assay design. See what steps they eliminate and how that would help expedite your qPCR experiment.

The postBio-Rad’s PrimePCR™ Assays and Panels Eliminate Multiple Steps from Your qPCR Workflowfirst appeared onBioradiations.]]>

In Pursuit of (Ig) Nobility: The Ig Nobel Prize

Bioradiations Staff

What is so noble about receiving an award? What if it is an Ig Nobel award? This article reviews what Ig Nobel awards are, how they are determined, and discusses some research topics that were awarded the Ig Nobel awards this year.

The postIn Pursuit of (Ig) Nobility: The Ig Nobel Prizefirst appeared onBioradiations.]]>

10 Tips and Tricks for Designing Multicolor Flow Cytometry Panels

Bioradiations Staff

Multiplexing an assay comes with its own complications in addition to the benefits it affords. Designing multicolor panels for flow cytometry analysis entails several considerations for a successful outcome. Here is a list of tips that can help you succeed in setting up and running a multicolor flow cytometry panel.

The post10 Tips and Tricks for Designing Multicolor Flow Cytometry Panelsfirst appeared onBioradiations.]]>

How to Minimize Contamination in qPCR Experiments

Bioradiations Staff

Are you using ethanol to prep your bench for qPCR? Watch this episode to find out why that might be a bad idea. We're sharing seven tips for minimizing contamination of qPCR experiments.

The postHow to Minimize Contamination in qPCR Experimentsfirst appeared onBioradiations.]]>

#6 What Factors Should You Consider for Chromatography Method Development

Bioradiations Staff

Explore some of the key considerations for chromatography method development.

The post#6 What Factors Should You Consider for Chromatography Method Developmentfirst appeared onBioradiations.]]>

Why Elephants Rarely Get Cancer: It’s in Their Genes

Bioradiations Staff

Why is cancer so rare in elephants? Scientists have observed this for decades, yet the explanation has eluded them until recently. Researchers at the University of Utah’s Huntsman Cancer Institute (HCI) and Arizona State University discovered elephants have extra copies of genes encoding p53, a tumor suppressor, and more robust apoptosis (programmed cell death) of damaged cells that may lead to cancer. According to the authors, these findings may aid future development of anti-cancer therapies in humans.

The postWhy Elephants Rarely Get Cancer: It’s in Their Genesfirst appeared onBioradiations.]]>

The Cure for Cancer Could Come from…Malaria?

Bioradiations Staff

Scientists have discovered that a protein commonly associated with malaria could one day lead to the cure for cancer. Found quite by accident, by researchers at the University of British Columbia and the University of Copenhagen studying why pregnant women are more susceptible to malaria, this protein binds to a particular type of sugar molecule that is found in the placenta and is prevalent in a high proportion of cancers. The researchers were not surprised by this finding, since cancers and the placenta both grow rapidly, often at the expense of other tissues.

The postThe Cure for Cancer Could Come from…Malaria?first appeared onBioradiations.]]>

Crows Do Fear the Reaper

Bioradiations Staff

Crows have been shown to associate dead bodies of their own kind with danger, and are also known to remember the faces of individual humans who have threatened them.

The postCrows Do Fear the Reaperfirst appeared onBioradiations.]]>

Radiation Therapy for Skin Cancer: All Wrapped Up in a Bandage

Bioradiations Staff

Most of us think of bandages as a way to protect cuts and abrasions against infection. However, recent research shows that a novel radiotherapeutic bandage may help treat squamous cell carcinoma (SCC). A group of scientists from the University of North Texas System College of Pharmacy presented their findings at the American Association of Pharmaceutical Sciences Annual Meeting and Exposition.

The postRadiation Therapy for Skin Cancer: All Wrapped Up in a Bandagefirst appeared onBioradiations.]]>

Bioradiations October Edition

Bioradiations Staff

See what new articles and videos are in the October edition of Bioradiations.

The postBioradiations October Editionfirst appeared onBioradiations.]]>

What Academic Researchers Can Learn from Small Biotechs about Antibody Validation

Bioradiations Staff

Academic labs don't have the money to do full-scale validations of antibodies. What tricks can small biotechs teach them about validation? Find out.

The postWhat Academic Researchers Can Learn from Small Biotechs about Antibody Validationfirst appeared onBioradiations.]]>

A Semi-Automated Quantitative PCR Approach to Assess Differential Anti-Apoptotic Gene Expression Patterns Associated with Prostate Cancer Progression

Bioradiations Staff

Gene expression analyses become complicated and extremely time consuming when large numbers of genes need to be analyzed. Here we present a semi-automated qPCR workflow with reduced setup and processing times using Bio-Rad's PrimePCR™ Panels and CFX Automation System II Plate Handler.

The postA Semi-Automated Quantitative PCR Approach to Assess Differential Anti-Apoptotic Gene Expression Patterns Associated with Prostate Cancer Progressionfirst appeared onBioradiations.]]>

Protocol: Preparation of Cells for Flow Cytometry

Bioradiations Staff

Harvesting of tissue culture cells could be challenging. Here is an easy protocol for efficient harvesting of cells for flow cytometry analysis.

The postProtocol: Preparation of Cells for Flow Cytometryfirst appeared onBioradiations.]]>

How to Design Primers for qPCR

Bioradiations Staff

How long should a qPCR primer be and what types of sequences should you avoid? In this episode we share eight tips and tricks for primer design for your qPCR experiments.

The postHow to Design Primers for qPCRfirst appeared onBioradiations.]]>

#5 How Do You Choose the Right Hardware for Your Chromatography Application?

Bioradiations Staff

Which valves, pumps or detectors are optimal for your FPLC system? How do you achieve optimal gradient performance? Here are some tips.

The post#5 How Do You Choose the Right Hardware for Your Chromatography Application?first appeared onBioradiations.]]>

Scientists Image Metabolites Secreted by Single Cells

Bioradiations Staff

Bacteria secrete small molecules for purposes that range from communication to self-defense. These processes are extremely challenging to study in situ because it is nearly impossible to link secreted molecules to specific populations of bacteria let alone individual cells in their natural environment. By combining mass spectrometry-based imaging with fluorescence in situ hybridization (FISH) scientists at the Max Planck Institute for Chemical Ecology are able to image secretion patterns of antibiotics and map them onto the FISH profile of the bacterial population that underlies it.

The postScientists Image Metabolites Secreted by Single Cellsfirst appeared onBioradiations.]]>

Need an Implant? Just Print It Out

Bioradiations Staff

Patients who need a life-saving implant may soon be able to get a customized one from a 3D printer. In the first procedure of its kind, surgeons replaced the sternum and a portion of the rib cage with a 3D-printed titanium sternum and rib implant. The procedure, performed in a 54-year-old Spanish man with a chest wall sarcoma, was reported in a recent issue of theEuropean Journal of Cardio-Thoracic Surgery。

The postNeed an Implant? Just Print It Outfirst appeared onBioradiations.]]>

Single Mutations Can Alter Ecosystems to Same Extent as Species Loss

Bioradiations Staff

To date most research into what drives the composition of ecosystems has focused on macroevolution, factors such as extinction events, invasion of new species, or large shifts in population abundances. A study inNature Communicationsnow shows that microevolution — small changes within a single population — is an equally important yet hitherto overlooked shaper of multi-species communities.

The postSingle Mutations Can Alter Ecosystems to Same Extent as Species Lossfirst appeared onBioradiations.]]>

Viruses Re-engineered to Do Good

Bioradiations Staff

Scientists at Stanford University recently repurposed viruses by removing their infectious machinery and turning them into vehicles for delivering therapies directly to cells. In their study, published in the Proceedings of the National Academy of Sciences, the scientists found a way to add molecular tags to the viral structure, which would enable them to target the viruses, and hence anything they are carrying, to a specific cell type.

The postViruses Re-engineered to Do Goodfirst appeared onBioradiations.]]>

A Non-Invasive Laser Doppler System Detects Malignant Melanoma

Bioradiations Staff

A recent study showed that a novel laser Doppler system effectively distinguished skin malignant melanoma from noncancerous moles by detecting subtle differences in blood flow beneath the skin, which may aid in rapid and non-invasive screening of patients.

The postA Non-Invasive Laser Doppler System Detects Malignant Melanomafirst appeared onBioradiations.]]>

A New Phage-engineering Platform Allows High-throughput Assembly of Hybrid Viral Genomes in Yeast

Bioradiations Staff

Bacteriophages target bacteria with high specificity, a feature that has been exploited for biotechnology and therapeutics. That same exquisite specificity has, however, also been limiting — identifying or engineering phages with new specificities is often a prohibitively time consuming and laborious process. Scientists at MIT have now developed a yeast-based phage-engineering platform that overcomes these hurdles.

The postA New Phage-engineering Platform Allows High-throughput Assembly of Hybrid Viral Genomes in Yeastfirst appeared onBioradiations.]]>

Want to Lose Weight? Check with Your Gut Microbiome

Bioradiations Staff

Researchers at Chalmers University of Technology recently identified how intestinal bacteria interact during metabolism, paving the way to, among other things, possibly personalizing weight-loss diets. The systems biologists developed a computational algorithm that is able to predict how modifying a person’s diet will affect them based on the bacterial and microorganismal composition of their gut microbiome.

The postWant to Lose Weight? Check with Your Gut Microbiomefirst appeared onBioradiations.]]>

Melting Body Fat: Is it In Your Head?

Bioradiations Staff

Muscles may not be the only organ that burns body fat. A recent study published in Cell showed that directly stimulating neurons in adipose (fat) tissue may induce breakdown, providing insight on novel therapies to combat obesity.

The postMelting Body Fat: Is it In Your Head?first appeared onBioradiations.]]>

Droplet Digital™ Applications: Phasing of Genetic Variants for CFTR Haplotyping

Bioradiations Staff

In this webinar, Dr. Jack Regan describes how the Droplet Digital PCR (ddPCR™）System can be used to determine whether genomic sequences are physically linked…

The postDroplet Digital™ Applications: Phasing of Genetic Variants for CFTR Haplotypingfirst appeared onBioradiations.]]>

Optimizing to Automation: The Advantages of Multidimensional (Multi-D) Chromatography

Bioradiations Staff

Philip Chapman of Bio-Rad Laboratories discusses the advantages of automated multidimensional (Multi-D) chromatography compared to traditional multistep purification strategies.

The postOptimizing to Automation: The Advantages of Multidimensional (Multi-D) Chromatographyfirst appeared onBioradiations.]]>

Can Cancer Cells be Programmed Back to Normal?

Bioradiations Staff

In a recent study published in Nature Cell Biology, researchers at the Mayo Clinic described a way in which cancer cells could potentially be programmed back into normal cells. Their findings were stimulated by the fact that proteins that hold cells together, or adhesion proteins, interact with the Microprocessor complex, which mediates the production of microRNAs (miRNAs).

The postCan Cancer Cells be Programmed Back to Normal?first appeared onBioradiations.]]>

Bioradiations September Edition

Bioradiations Staff

See what new articles and videos are in the September edition of Bioradiations.

The postBioradiations September Editionfirst appeared onBioradiations.]]>

Four Tips for Developing a Sample Prep Protocol for SDS-PAGE or Chromatography

Bioradiations Staff

From making sure that your lysis buffer is compatible with your protein quantitation method to advice on when you do and don't have to worry about proteases, we share helpful tips for developing a sample preparation protocol.

The postFour Tips for Developing a Sample Prep Protocol for SDS-PAGE or Chromatographyfirst appeared onBioradiations.]]>

Five Tips for Picking the Right Cell Disruption Method for Protein Analysis

Bioradiations Staff

Sonicator or freeze-thaw? Detergent or enzymatic lysis? Find out how to pick the right cell disruption method for your experiment.

The postFive Tips for Picking the Right Cell Disruption Method for Protein Analysisfirst appeared onBioradiations.]]>

A Pungent Play in the Game of Cat and Mouse

Bioradiations Staff

It was discovered a few years ago that the parasiteToxoplasma gondiihas the diabolical effect of short circuiting the fear of cats in the brains of mice, making them easy picking. Researchers at the A.N. Severtov Institute of Ecology and Evolution in Moscow now show that a more readily abundant substance has a similar effect: the cats’ own urine.

The postA Pungent Play in the Game of Cat and Mousefirst appeared onBioradiations.]]>

Breastmilk and Human Microbiome Development

Bioradiations Staff

The importance of gut microbes to well-being is one of the hottest topics in health. Another is the benefits of breastfeeding. It’s popularly assumed that breastmilk supports a healthy microbiome in infants, but what does the research show? A new review article inScienceoutlines what we know and don’t know about how this support may work.

The postBreastmilk and Human Microbiome Developmentfirst appeared onBioradiations.]]>

Revealing the Secrets of How Cancers Could Occur

Bioradiations Staff

In an article recently published inNature Communications单击功能区上，researchers at the University of Toronto, along with scientists at Mount Sinai Hospital, demonstrated how what they call DNA ambulances work. These DNA ambulances transport severely injured DNA to specialized locations, or hospitals, within the cell to be repaired. In addition to the mode of transport, the researchers also found the road traveled by these healing transporters.

The postRevealing the Secrets of How Cancers Could Occurfirst appeared onBioradiations.]]>

From Child to Mother: Fetal Cells in Maternal Tissue May Impact Maternal Health After Childbirth

Bioradiations Staff

Most of us probably know that the mother’s health is important for the well-being of their developing fetus. However, a recent study published in BioEssays suggests that the fetus may also affect the health of its mother — even after the pregnancy is over. The study showed that fetal cells migrate from the placenta and reside in several parts of the mother’s body, where they may exert benefits (such as improved milk production and thermoregulation), harms (such as autoimmune diseases and cancer), or have no effect (such as their presence in the lung).

The postFrom Child to Mother: Fetal Cells in Maternal Tissue May Impact Maternal Health After Childbirthfirst appeared onBioradiations.]]>

A New Way to PCR Could Get You Results in Minutes Instead of Hours

Bioradiations Staff

Whether you are using PCR to clone, assess gene expression, or diagnose disease, modern science is difficult to imagine without PCR. Scientists at UC Berkeley have rethought how we heat and cool samples during PCR, shortening a process that once took hours to minutes.

The postA New Way to PCR Could Get You Results in Minutes Instead of Hoursfirst appeared onBioradiations.]]>

#4 How Do You Listen to Your FPLC UV Detector?

Bioradiations Staff

Here are some tips to fix random spikes in your peaks and pulsations in your gradient.

The post#4 How Do You Listen to Your FPLC UV Detector?first appeared onBioradiations.]]>

Trends in Antibody Generation Techniques — the Fully Synthetic Human Combinatorial Antibody Library (HuCAL®) Technology

Bioradiations Staff

From using nonspecific polyclonal antibodies to developing monoclonal antibodies from immortalized antibody-producing cells to antibody engineering and generation of antibodies using an animal-free library with billions of antibody fragments to choose from, the antibody technology has seen tremendous advances. Explore where this journey started and what the current trends are and what the human combinatorial antibody library (HuCAL) technology destination has to offer!

The postTrends in Antibody Generation Techniques — the Fully Synthetic Human Combinatorial Antibody Library (HuCAL®) Technologyfirst appeared onBioradiations.]]>

Bio-Rad’s Multi-D Method Addresses Unmet Chromatography Needs

Bioradiations Staff

Some of the frustrations in protein purification stem from unmet chromatography needs, such as automation, productivity, throughput, and reproducibility among others. Bio-Rad’s new Multi-D chromatography method addresses these and provides solutions to faster, efficient and more reliable protein purification.

The postBio-Rad’s Multi-D Method Addresses Unmet Chromatography Needsfirst appeared onBioradiations.]]>

Ultra-Sensitive Quantification of Genome Editing Events Using Droplet Digital PCR

Bioradiations Staff

Genome editing using tools such as CRISPR/Cas9 and TALEN has gained enormous popularity in recent days due to their ability to create precise deletions or insertions. However when the frequency of these gene edits are really small, an ultrasensitive method like ddPCR™ is needed for accurate quantification. This technote explains how Droplet Digital™ PCR is used for the detection of HDR and NHEJ alleles generated using CRISPR/Cas9 and TALEN editing systems.

The postUltra-Sensitive Quantification of Genome Editing Events Using Droplet Digital PCRfirst appeared onBioradiations.]]>

#3 How Do You Care for Your Chromatography System?

Bioradiations Staff

Here are some handy tips for maintaining your chromatography columns in great shape.

The post#3 How Do You Care for Your Chromatography System?first appeared onBioradiations.]]>

Bioradiations August Edition

Bioradiations Staff

See what new articles and videos are in the August edition of Bioradiations.

The postBioradiations August Editionfirst appeared onBioradiations.]]>

CRISPR: The Hopes, the Fears, and the Biology

Bioradiations Staff

Few discoveries have changed the pace of discovery and the types of questions we can ask as drastically and quickly as CRISPR-based genome editing. But where did CRISPR come from? How was it adapted to become such a game-changing genome editing tool? And why are some of its greatest proponents alarmed?

The postCRISPR: The Hopes, the Fears, and the Biologyfirst appeared onBioradiations.]]>

Four Tips for Handcasting SDS-PAGE Gels

Bioradiations Staff

Watch this episode of LabNotes for helpful tips like how to pour the stacking and resolving gel at the same time.

The postFour Tips for Handcasting SDS-PAGE Gelsfirst appeared onBioradiations.]]>

Four Tips for Running the Perfect SDS-PAGE Gel

Bioradiations Staff

We share five simple tricks that address common gel running woes, from samples that float out of wells to sample buffers that turn yellow.

The postFour Tips for Running the Perfect SDS-PAGE Gelfirst appeared onBioradiations.]]>

The Antibody Challenge: Bio-Rad’s Precise Solution

Bioradiations Staff

Why western blotting, a technique used in every day research, is still not as straightforward as it seems? Well, it’s mainly because of the antibodies. They may not work in all samples, a lot of standardization needs to be done and there are several other unknowns. Bio-Rad, the leader in western blotting, has addressed these concerns in its newest line of antibodies, the PrecisionAb™ Antibodies. See the challenges and the Bio-Rad solution.

The postThe Antibody Challenge: Bio-Rad’s Precise Solutionfirst appeared onBioradiations.]]>

TOR Pathway Allows Yeast to Optimize Their Genome in Response to Environmental cChanges

Bioradiations Staff

It is generally accepted that changes to a cell’s genome are driven by random mutation. Changes that confer a growth advantage become established in a population through the process of natural selection. A study published inPNASsuggests that cells can play a more active role in the evolution of their genomes — in response to caloric excess the TOR pathway in budding yeast initiates an expansion of the number of ribosomal genes.

The postTOR Pathway Allows Yeast to Optimize Their Genome in Response to Environmental cChangesfirst appeared onBioradiations.]]>

Cannabis-Based Therapies Without the Side Effects: A New Treatment Paradigm for Cancer?

Bioradiations Staff

Recently, scientists at the University of East Anglia (UEA) and the University Pompeu Fabra in Barcelona, Spain identified that inhibition of a signaling pathway in the brain, involving both a cannabinoid receptor and a serotonin receptor, prevented the undesirable side effects of THC while maintaining its therapeutic potential.

The postCannabis-Based Therapies Without the Side Effects: A New Treatment Paradigm for Cancer?first appeared onBioradiations.]]>

Aliens in Our Midst

Bioradiations Staff

As we seek out organic compounds and water on the surface of Mars, ponder the potential for hidden oceans on Europa, and discover new Earth-like exoplanets, the promise of astrobiology — namely, alien life in some form — seems closer than ever to reality. Yet what if aliens are already here on Earth, not as otherworldly visitors but alternative organisms, separately evolved and existing in a shadow biosphere?

The postAliens in Our Midstfirst appeared onBioradiations.]]>

Our Cells Unwittingly Support Viral Entry and Infection

Bioradiations Staff

Human adenoviruses comprise 25% of all gene therapy clinical trials due, in part, to their ability to infect both dividing and nondividing cells with persistent expression. Recently, researchers at the University of Zurich demonstrated how these viruses gain entry into our cells — and it’s quite sneaky!

The postOur Cells Unwittingly Support Viral Entry and Infectionfirst appeared onBioradiations.]]>

How the Microbiome of Soil Affects Global Warming

Bioradiations Staff

The ground beneath our feet is teeming with microbial life—approximately 10 billion organisms in an average handful of soil. Now, thanks to modern genetic sequencing methods, researchers are getting surprising insights into the vibrant world of dirt.

The postHow the Microbiome of Soil Affects Global Warmingfirst appeared onBioradiations.]]>

Gut Microbiome May Predict Progression of Colon Cancer

Bioradiations Staff

The gut microbiome has been linked to a wide range of health indicators over recent years and, according to a recent study published inGenome Medicine单击功能区上，may help predict prognosis of patients with colon cancer. In this study, the microenvironment of colon cancer tumors had an abundance of Fusobacterium and Providencia species, perhaps identifying a microbiome signature that predicts patient prognosis.

The postGut Microbiome May Predict Progression of Colon Cancerfirst appeared onBioradiations.]]>

The Youth Factor: It’s in Your Blood

Bioradiations Staff

Finding ways to slow or reverse aging intrigues scientists and non-scientists alike. In recent studies, merging the circulatory systems of young and old mice rejuvenated skeletal muscle, brain, and cardiac cells, indicating the presence of a systemic “anti-aging factor” initially thought to be growth differentiation factor 11 (GDF11). However, a recent publication showed that GDF11 actually promotes aging, emphasizing the need for further integrative analysis of the aging process.

The postThe Youth Factor: It’s in Your Bloodfirst appeared onBioradiations.]]>

#2 How Do You Best Prepare Your Columns for Chromatography?

Bioradiations Staff

Here are some tips for attaching, filling or running your chromatography columns.

The post#2 How Do You Best Prepare Your Columns for Chromatography?first appeared onBioradiations.]]>

Get Published! 10 Tips for Getting Published Successfully

Bioradiations Staff

When you have finished all your experiments and have the paper ready in your head, you need to consider several factors before sending it for publication. Here are some tips that Bio-Rad’s PrimePCR™ PCR Primers and Assays group put together for getting the paper published successfully.

The postGet Published! 10 Tips for Getting Published Successfullyfirst appeared onBioradiations.]]>

Bioradiations July Edition

Bioradiations Staff

See what new articles and videos are in the July edition of Bioradiations.

The postBioradiations July Editionfirst appeared onBioradiations.]]>

Choosing the Right Percentage Gel

Bioradiations Staff

Unsure about what percentage SDS-PAGE gel to pick for your experiment? We share four tips that make picking the perfect gel a piece of cake.

The postChoosing the Right Percentage Gelfirst appeared onBioradiations.]]>

Automated Multi-D Chromatography on the NGC™ System

Bioradiations Staff

What is Multidimensional (Multi-D) chromatography? Here is an animated explanation of how Multi-D chromatography works and what its advantages are over traditional chromatography.

The postAutomated Multi-D Chromatography on the NGC™ Systemfirst appeared onBioradiations.]]>

Next Generation Computers: Transforming Cells into Autonomous Computing Devices

Bioradiations Staff

What do computers and cells have in common? Can cells function as computers or recording devices? Can a bacterial computer be built? Synthetic biologists have recently developed a platform called SCRIBE (Synthetic Cellular Recorders Integrating Biological Events) to convert genomic DNA into a “tape” for recording and memorizing information. This article explores many interesting aspects of autonomous cellular memory and the potential applications of such living computational systems.

The postNext Generation Computers: Transforming Cells into Autonomous Computing Devicesfirst appeared onBioradiations.]]>

What’s in An Instrument Nickname?

Bioradiations Staff

Researchers love their lab instruments…and sometimes hate them too. Out of such complex human-machine relationships come nicknames, many many nicknames. Read on to explore the ways scientists name their instruments, the names they choose, and contribute your favorite instrument nickname!

The postWhat’s in An Instrument Nickname?first appeared onBioradiations.]]>

Six Things You Might Not Know About Bio-Rad’s Food Science Division (FSD)

Bioradiations Staff

What’s the science that keeps your food safe? Find out with an inside look at Bio-Rad’s Food Science Division, and discover how techniques from the research lab are applied every day to guard what you eat.

The postSix Things You Might Not Know About Bio-Rad’s Food Science Division (FSD)first appeared onBioradiations.]]>

Advantages of Multidimensional (Multi-D) Chromatography Using the NGC™ Chromatography System over Traditional Sequential Chromatography

Bioradiations Staff

Traditional sequential chromatography typically requires intensive hands-on user manipulation, which could hinder the reproducibility of protein purification runs. Multi-D chromatography aims to improve this process while maintaining the efficacy of the traditional workflow.

The postAdvantages of Multidimensional (Multi-D) Chromatography Using the NGC™ Chromatography System over Traditional Sequential Chromatographyfirst appeared onBioradiations.]]>

Minimizing Protein Degradation

Bioradiations Staff

In this episode, we share tips and tricks for minimizing protein degradation during cell lysis and sample preparation.

The postMinimizing Protein Degradationfirst appeared onBioradiations.]]>

Mitochondria and Plastids Evolved in Miniscule Plankton to Form Eye-like Structure

Bioradiations Staff

An eye-like structure called the ocelloid, found in warnowiid dinoflagellates, has long puzzled biologists. This structure resembles the eye of higher organisms to such a degree, that is was first assumed to be part of an animal the warnowiid had eaten. Now this small eukaryotic plankton has surprised scientists again – the warnowiid eye’s building blocks are mitochondria and plastids.

The postMitochondria and Plastids Evolved in Miniscule Plankton to Form Eye-like Structurefirst appeared onBioradiations.]]>

A Fifth DNA Base?

Bioradiations Staff

A ubiquitous but rare DNA base, previously thought to be a transitional chemical modification of cytosine, has now been shown to be stably incorporated in mammalian DNA. 5-formylcytosine (5fC) is found in all tissues, with the highest levels being found in the brain. Its exact function is unknown, but its physical position in the genome suggests that it plays a key role in gene expression.

The postA Fifth DNA Base?first appeared onBioradiations.]]>

Disrupting the Regeneration of Brain Tumors

Bioradiations Staff

Brain tumors such as glioblastomas are exceptionally difficult to treat since, irrespective of how they were treated, they find a way to regenerate. This ability can be attributed to cancer stem cells that circumvent treatment and trigger the expansion of new tumor cells. Recently, scientists at Washington University School of Medicine in St. Louis discovered a way to disrupt the regeneration of brain tumors by disrupting a key player in the brain tumor stem cell maintenance process.

The postDisrupting the Regeneration of Brain Tumorsfirst appeared onBioradiations.]]>

Growing Mini-Breasts for Cancer Research

Bioradiations Staff

Researchers often use two-dimensional cell culture studies to study cancer biology. However, a recent group of researchers, led by Dr. Christina Scheel at the German Research Center for Environmental Health, has advanced this experimental model by creating three-dimensional “mini-breasts”— organoid structures derived from human breast epithelial cells.

The postGrowing Mini-Breasts for Cancer Researchfirst appeared onBioradiations.]]>

Paleontology Gets a Shot of Dinosaur Protein

Bioradiations Staff

In all but the best-preserved fossils, researchers have assumed that intact soft tissues did not survive longer than about 4 million years. A few protein fragments might persist; however, full proteinaceous structures that could tell us about soft tissues and animal physiology would not.

The postPaleontology Gets a Shot of Dinosaur Proteinfirst appeared onBioradiations.]]>

Social Amoeba Answer Age-Old Question: Do Cheaters Always Win?

Bioradiations Staff

The social amoebaDictyostelium discoideumhas two life stages. When nutrients are plentiful, Dicty live as individuals but when starvation sets in, thousands of Dicty come together to form a fruiting body. This fruiting body is made up of a stalk that holds up a ball of spores, and this is where the cheating comes in — only cells that make it to the top of the fruiting body and become a spore get to live and pass on their genetic information.

The postSocial Amoeba Answer Age-Old Question: Do Cheaters Always Win?first appeared onBioradiations.]]>

A “Google Maps” Approach to Navigate the Cancer Genome

Bioradiations Staff

Researchers have made significant progress recently in the development of personalized cancer genomics and therapies through analysis of characteristic variations of single base pairs and chromosomes. Recently, researchers at the University of Wisconsin-Madison used an integrated system of DNA sequencing and optical mapping (a single-molecule, whole-genome analysis system) to identify both small- and large-scale genetic variations over time in a patient with multiple myeloma. Their findings were published on June 8, 2015 in the Proceedings of the National Academy of Sciences.

The postA “Google Maps” Approach to Navigate the Cancer Genomefirst appeared onBioradiations.]]>

#1 How Do You Best Prepare Your Protein Samples for Purification?

Bioradiations Staff

Here are some tips to clarify your lysate, filter proteins, and to achieve optimal binding of your proteins.

The post#1 How Do You Best Prepare Your Protein Samples for Purification?first appeared onBioradiations.]]>

High Quality Gene Expression from Precious Samples — A Simplified Workflow

Bioradiations Staff

Obtaining enough starting material to complete multiple gene expression experiments can be challenging when working with precious and limited samples. Find out how Mark Kibschull of the Lunenfeld-Tanenbaum Research Institute in Toronto determines pluripotency and differentiation of limited human embryonic stem cells using Bio-Rad's SingleShot Cell Lysis Kit, PreAmp Supermix, and PrimePCR validated primer panels. This simplified workflow allows for the gene expression analysis of hundreds of genes from as little as 100 human embryonic stem cells, and without the cumbersome step of isolating and purifying RNA.

The postHigh Quality Gene Expression from Precious Samples
— A Simplified Workflowfirst appeared onBioradiations.]]>

Bioradiations June Edition

Bioradiations Staff

Get a quick look to see what new articles and videos are in the June edition.

The postBioradiations June Editionfirst appeared onBioradiations.]]>

Too Many Questions, Too Little Sample: Developing a Real-Time PCR Workflow for Monitoring Gene Expression in Limited Samples

Bioradiations Staff

Traditional real-time PCR workflows often limit the number of genes that can be studied, especially when sample amounts are small. A new workflow now allows Mark Kibschull of the Lunenfeld-Tanenbaum Research Institute in Toronto to track the expression of hundreds of genes using a fraction of the starting material required by traditional methods.

The postToo Many Questions, Too Little Sample: Developing a Real-Time PCR Workflow for Monitoring Gene Expression in Limited Samplesfirst appeared onBioradiations.]]>

7 Tips for Choosing the Right Antibody for Western Blotting

Bioradiations Staff

Which antibody is the best to obtain a definitive and conclusive answer for my questions? How do I choose the best antibody for my purpose? These are standard questions that scientists ask time and time again. Here are a few tips to choose the most appropriate antibody for your specific application.

The post7 Tips for Choosing the Right Antibody for Western Blottingfirst appeared onBioradiations.]]>

Adding Another Dimension to Cancer Research: Three-dimensional Printing of Cancer Cells

Bioradiations Staff

Traditionally, researchers have relied on two-dimensional single-layer cell culture to analyze the physiological characteristics of tumor cells and their response to anti-cancer therapies. However, an international team of scientists recently used a three-dimensional (3D) printer to construct a three-dimensional (3D) model of a cancerous tumor, which may provide a more realistic representation of the tumor’s microenvironment and thus improve knowledge on how tumors develop, grow, and spread.

The postAdding Another Dimension to Cancer Research: Three-dimensional Printing of Cancer Cellsfirst appeared onBioradiations.]]>

A New Player in the Fight against Ebola

Bioradiations Staff

An international team of scientists recently identified the molecular factor that the Ebola virus attaches to in order to gain entry into host cells. The host protein, Neimann-Pick C1 (NPC1), is embedded in the membrane of lysosomes and allows the virus to gain entry to the cytoplasm, where the productive infection occurs. The study, which expanded upon findings from an earlier in vitro study, was carried out in NPC1 wild type, carrier, and knockout mice.

The postA New Player in the Fight against Ebolafirst appeared onBioradiations.]]>

With Potential Illicit Yeast Strains, Biology’s Breaking Bad Has Arrived

Bioradiations Staff

Another week, another warning about the growing power and peril of genomic modification. Last time, the topic was using the CRISPR/Cas9 gene editing method to alter the human germ line (a group of researchers promptly published on how they did just this). Now, a new commentary inNaturetakes up the implications of using modified yeast to produce controlled substances such as opiates.

The postWith Potential Illicit Yeast Strains, Biology’sBreaking BadHas Arrivedfirst appeared onBioradiations.]]>

Cyclic di-GMP Acts as a Cyclin-like Molecule to Control Cell Cycle Progression in Bacteria

Bioradiations Staff

Cell division is a complicated process that requires not only cell growth and division but also faithful replication of the mother cell genome. These processes need to be timed appropriately to end up with two viable daughter cells. In eukaryotic cells cell cycle progression is controlled by oscillating proteins called cyclins that bind and activate cyclin-dependent kinases (Cdks).

The postCyclic di-GMP Acts as a Cyclin-like Molecule to Control Cell Cycle Progression in Bacteriafirst appeared onBioradiations.]]>

Putting Cells “to Sleep”: a Novel, Gentler Way to Treat Cancer

Bioradiations Staff

Traditional treatment for cancer often focuses on killing the malignant cells through radiotherapy or chemotherapy. However, researchers at Oregon State University are investigating the use of pactamycin analogs to inhibit proliferation and induce senescence of head and neck cancer cells — essentially putting them “to sleep” rather than killing them directly.

The postPutting Cells “to Sleep”: a Novel, Gentler Way to Treat Cancerfirst appeared onBioradiations.]]>

Researcher Profile: Suzanne Topalian Pioneers PD-1 Inhibitor Drug to Treat Advanced Cancer

Bioradiations Staff

Suzanne Topalian was recognized in 2014 byNatureas one of “Ten People Who Mattered This Year” for her contributions in pioneering nivolumab, a programmed cell death protein-1 (PD-1) inhibitor that was recently approved in Japan for advanced melanoma treatment and that shifts the paradigm for a wide range of cancer therapies.

The postResearcher Profile: Suzanne Topalian Pioneers PD-1 Inhibitor Drug to Treat Advanced Cancerfirst appeared onBioradiations.]]>

Teaching Inquiry in the Classroom

Bioradiations Staff

A look inside Julianne Zedalis' classroom at The Bishop's School in San Diego, CA, gives a glimpse of how a master teacher implements inquiry in her classroom. Bio-Rad's ThINQ! Investigations enable instructors to guide students through real-world inquiry investigations. These labs meet the revised College Board curriculum requirements and are aligned to AP Biology Big Ideas; they are designed to connect inquiry to NGSS and college curricula, encouraging students to think like real scientists.

The postTeaching Inquiry in the Classroomfirst appeared onBioradiations.]]>

Cell Imaging Simplified – the ZOE™ Fluorescent Cell Imager

Bioradiations Staff

The ZOE fluorescent cell imager features an integrated digital camera and touch-screen interface that makes brightfield and multichannel fluorescence microscopy simple, fast, and intuitive. An easy-to-use alternative to the traditional inverted microscope, ZOE eliminates the complexities of multichannel fluorescence imaging by combining the ease of use of a personal tablet and the power of an inverted microscope.

The postCell Imaging Simplified – the ZOE™ Fluorescent Cell Imagerfirst appeared onBioradiations.]]>

3 Moments of Inquiry with Bio-Rad’s pGLO™ Transformation and Inquiry for AP Biology: A ThINQ! Investigation Kit

Bioradiations Staff

“Inquiry-based” is the new buzzphrase in science education. But what do these learning practices look like on the ground? Visit one high school in Southern California and find out about this new approach to teaching science.

The post3 Moments of Inquiry with Bio-Rad’s pGLO™ Transformation and Inquiry for AP Biology: A ThINQ! Investigation Kitfirst appeared onBioradiations.]]>

Introducing the ZOE™ Fluorescent Cell Imager for Routine Cell Culture and Fluorescent Imaging Applications

Bioradiations Staff

Using traditional fluorescence microscopes for everyday cell imaging can be frustrating, with a lot of time spent in the darkroom mastering a highly specialized piece of equipment, all to accomplish relatively simple tasks. The ZOE Fluorescent Cell Imager eliminates the complexities of cell imaging by combining the ease of use of a personal tablet with the power of an inverted microscope. Check it out.

The postIntroducing the ZOE™ Fluorescent Cell Imager for Routine Cell Culture and Fluorescent Imaging Applicationsfirst appeared onBioradiations.]]>

SureBeads™ Magnetic Beads Standard Immunoprecipitation Protocol

Bioradiations Staff

Immunoprecipitation (IP) is a commonly used protocol for concentrating and purifying proteins using specific antibodies and magnetic beads. Here is a simple IP protocol using Bio-Rad’s SureBeads Magnetic Beads.

The postSureBeads™ Magnetic Beads Standard Immunoprecipitation Protocolfirst appeared onBioradiations.]]>

What effects are microplastics having on ocean life?

Bioradiations Staff

Large amounts of plastics are entering our oceans, with especially high levels found near coastal cities and, most famously, in the Great Pacific garbage patch. But what are the effects of all this plastic on the life that makes up ocean ecosystems? A new review looks at just how scientists are answering this question, from measuring these pollutants to understanding their interactions with biological systems.

The postWhat effects are microplastics having on ocean life?first appeared onBioradiations.]]>

Human Gene Knockouts Predict Disease Risk

Bioradiations Staff

Researchers have used “knockout” mice for decades to study how loss of gene function contributes to diseases. Recently, researchers at the University of Texas Health Science Center (UT Health) at Houston have investigated this gene-disease relationship using naturally occurring “knockout humans.”

The postHuman Gene Knockouts Predict Disease Riskfirst appeared onBioradiations.]]>

Find the Latest Research and Information on Parkinson’s Disease In a New Open Access Journal

Bioradiations Staff

Nature Publishing Group has recently introduced a new, free journal dedicated to Parkinson’s disease (PD). This new open-access journal aims to present both the latest research findings and advances on PD, as well as ideas and options for care and treatment, and information on drugs and clinical trials. The journal will also have brief summaries of research work presented in a manner that is easily understood by anybody seeking information on this disease.

The postFind the Latest Research and Information on Parkinson’s Disease In a New Open Access Journalfirst appeared onBioradiations.]]>

Simple Measurement Could Bring Abandoned Antibiotics Back to the Clinic

Bioradiations Staff

Scientists at Duke University have developed a simple method for fine-tuning antibiotic dosing protocols that could allow use of antibiotics that have been all but abandoned. Computer models and preliminary laboratory work suggest that by determining a pathogen’s recovery time after exposure to an antibiotic, a dosing regimen can be established that allows clearing of what at present are considered resistant strains.

The postSimple Measurement Could Bring Abandoned Antibiotics Back to the Clinicfirst appeared onBioradiations.]]>

Novel Blood Test Predicts Breast Cancer Up to 7 Years Before it Occurs

Bioradiations Staff

Mammograms have been used for nearly six decades to screen for breast cancer. However, a new blood test may accurately detect breast cancer years before it develops, according to a recently published article inMetabolomics。

The postNovel Blood Test Predicts Breast Cancer Up to 7 Years Before it Occursfirst appeared onBioradiations.]]>

Heterochromatin — Key Player in the Aging Process?

Bioradiations Staff

In a recently published paper in Science, scientists at the Salk Institute and Chinese Academy of Sciences showed that Werner syndrome, a rare genetic disorder that leads to premature aging, is caused by a deterioration of DNA bundles known as heterochromatin.

The postHeterochromatin — Key Player in the Aging Process?first appeared onBioradiations.]]>

Bio-Plex Pro Human Inflammation Assays: Performance Data

Bioradiations Staff

Bio-Rad’s Bio-Plex Pro Human Inflammation Assay measures 37 of the most relevant inflammation biomarkers, including TNF superfamily proteins, Treg cytokines, IFN proteins, and matrix metalloproteinases, in a single multiplex panel.Check out the performance characteristics of the assay panel in this report.

The postBio-Plex Pro Human Inflammation Assays: Performance Datafirst appeared onBioradiations.]]>

Tips for Keeping Your NGC™ Chromatography System in Great Shape

Bioradiations Staff

Doing these three simple checks will protect your chromatography system from common lab hazards.

The postTips for Keeping Your NGC™ Chromatography System in Great Shapefirst appeared onBioradiations.]]>

Tips for Using Chromatography Columns with Your NGC™ Chromatography System

Bioradiations Staff

Here are the methods you need to ensure optimal, long-lasting column performance.

The postTips for Using Chromatography Columns with Your NGC™ Chromatography Systemfirst appeared onBioradiations.]]>

Tips for Sample Preparation with Your NGC™ Chromatography System

Bioradiations Staff

Follow these steps to go from crude cell lysate to a sample that’s ready to purify.

The postTips for Sample Preparation with Your NGC™ Chromatography Systemfirst appeared onBioradiations.]]>

Tips for Storing Proteins Purified on Your NGC™ Chromatography System

Bioradiations Staff

Get the most out of your proteins, including better stability, the best ways to freeze fractions, and more!

The postTips for Storing Proteins Purified on Your NGC™ Chromatography Systemfirst appeared onBioradiations.]]>

Tips for Preparing and Using Buffers with Your NGC™ Chromatography System

Bioradiations Staff

Here are four fast and easy things that will help you maintain peak performance for your medium pressure chromatography system. Beat contamination and save your samples!

The postTips for Preparing and Using Buffers with Your NGC™ Chromatography Systemfirst appeared onBioradiations.]]>

Bioradiations Looks Back: 50 Years as Bio-Rad’s Life Science Resource

Bioradiations Staff

Bioradiations, Bio-Rad’s technical resource for life science research, sent out its first issue in 1965. How did this publication evolve in the years that followed? Take a look in our archives and find out!

The postBioradiations Looks Back: 50 Years as Bio-Rad’s Life Science Resourcefirst appeared onBioradiations.]]>

PureBlu™ Hoechst 33342 Nuclear Staining Dye for Live Cells – A Fast Approach to Staining Nuclei

Bioradiations Staff

PureBlu Hoechst 33342 Nuclear Staining Dye is the optimal choice for staining the nuclei of live cells for ultraviolet imaging. This short video goes through the steps involved in staining live cells with PureBlu Hoechst 33342 Nuclear Staining Dye.

The postPureBlu™ Hoechst 33342 Nuclear Staining Dye for Live Cells – A Fast Approach to Staining Nucleifirst appeared onBioradiations.]]>

How to Build a Custom PrimePCR™ Real-Time PCR Plate Using a Suggested or Blank Template

Bioradiations Staff

It’s fast and easy to build your own PrimePCR plate. This video walks you through using the Custom Plate Configurator at Bio-Rad.com to create your own 96- or 384-well PCR plate.

The postHow to Build a Custom PrimePCR™ Real-Time PCR Plate Using a Suggested or Blank Templatefirst appeared onBioradiations.]]>

PrimePCR™ Pathway and Disease Panels – How to Modify a Predesigned Plate

Bioradiations Staff

One easy way to obtain a PrimePCR plate customized for your research is to modify one of Bio-Rad’s predesigned panels. This short video tutorial shows you how to use the online tools at Bio-Rad.com to edit a predesigned plate and create, then order your own customized 96- or 384-well PCR plate.

The postPrimePCR™ Pathway and Disease Panels – How to Modify a Predesigned Platefirst appeared onBioradiations.]]>

PureBlu™ DAPI Nuclear Staining Dye for Fixed Cells – A Fast Approach to Staining Nuclei

Bioradiations Staff

PureBlu DAPI Nuclear Staining Dye is the optimal choice for staining the nuclei of fixed cells for ultraviolet imaging. This short video goes through the steps involved in staining live cells with PureBlu DAPI Nuclear Staining Dye.

The postPureBlu™ DAPI Nuclear Staining Dye for Fixed Cells – A Fast Approach to Staining Nucleifirst appeared onBioradiations.]]>

Cross-Reactivity of Bio-Plex Pro™ Human Cancer Biomarker Assays to Mouse Proteins

Bioradiations Staff

Mice are an optimal model organism for human cancer studies. However, when experiments involve a human xenograft in a mouse host, cross-reactivity presents a major concern in measuring biomarkers. This technical report evaluates 14 Bio-Plex Pro Human Cancer Biomarker Assays for cross reactivity to mouse proteins and discusses the resulting data.

The postCross-Reactivity of Bio-Plex Pro™ Human Cancer Biomarker Assays to Mouse Proteinsfirst appeared onBioradiations.]]>

Investigating Cancer Stem Cells with the S3™ Cell Sorter

Bioradiations Staff

The Cancer Stem Cell model proposes that a special group of dormant cells in the cancer population plays a key role in tumor development and growth, as well as regeneration following treatment. Find out how researchers Stacy Blain and Danielle Joseph are using the S3 Cell Sorter in studying potential cancer stem cells for multiple myeloma.

The postInvestigating Cancer Stem Cells with the S3™ Cell Sorterfirst appeared onBioradiations.]]>

Investigating Cancer Stem Cells with the S3™ Cell Sorter

Bioradiations Staff

At SUNY Downstate Medical Center in Brooklyn, New York, researchers Stacy Blain and Danielle Joseph are trying to find out how the Cancer Stem Cell model might apply to multiple myeloma. See how they use Bio-Rad’s S3 Cell Sorter to isolate a small population of cells that might play an important role in this disease.

The postInvestigating Cancer Stem Cells with the S3™ Cell Sorterfirst appeared onBioradiations.]]>

How to Order PrimePCR™ Assays – Primers, Probes, and Panels

Bioradiations Staff

A wide range of PCR assays is available through Bio-Rad.com for use with real-time or Droplet Digital™ PCR systems. Get a quick refresher on ordering these products with this short video.

The postHow to Order PrimePCR™ Assays – Primers, Probes, and Panelsfirst appeared onBioradiations.]]>

You Get to Do This？–The Bio-Rad Science Ambassador Program at the 2014 Bay Area Science Festival

Bioradiations Staff

The Bio-Rad Science Ambassador Program participated in the 2014 Bay Area Science Festival's Discovery Days at AT&T Park event. See one volunteer Science Ambassador talk about conducting a real DNA experiment with students.

The postYou Get to Do This？–The Bio-Rad Science Ambassador Program at the 2014 Bay Area Science Festivalfirst appeared onBioradiations.]]>

Now I Have My Own DNA–The Bio-Rad Science Ambassador Program at the 2014 Bay Area Science Festival

Bioradiations Staff

See a range of students talk about the unique experience of extracting their own DNA，and one volunter Science Ambassador talk about conducting a real DNA experiment with students。

The postNow I Have My Own DNA–The Bio-Rad Science Ambassador Program at the 2014 Bay Area Science Festivalfirst appeared onBioradiations.]]>

Discovery Days at World Series HQ, Mini Makers, and More: The Bio-Rad Science Ambassador Program in 2014 and Beyond

Bioradiations Staff

From running science experiments on the home field of World Series champions the San Francisco Giants, to connecting with makers in “the nerd nest,” to hundreds of new classroom events, 2014 has been an exciting year for the Bio-Rad Science Ambassador Program. Learn about the latest highlights in this corporate social responsibility program and watch a video of participating students and scientists.

The postDiscovery Days at World Series HQ, Mini Makers, and More: The Bio-Rad Science Ambassador Program in 2014 and Beyondfirst appeared onBioradiations.]]>

Ebola: New Techniques for Diagnosis, Treatment, and Prevention

Bioradiations Staff

The 2014 West African Ebola outbreak has been an unprecedented public health emergency, with thousands infected across multiple countries and cases spreading internationally. This article examines the science behind this deadly hemorrhagic fever, including its pathogenesis, detection, the challenges it presents in the field, and research into new therapies such as monoclonal antibodies.

The postEbola: New Techniques for Diagnosis, Treatment, and Preventionfirst appeared onBioradiations.]]>

The Brain’s GPS — Unraveling the Functioning of Our Navigation System

Bioradiations Staff

This year’s Nobel Prize in Physiology and Medicine was awarded to three neuroscientists for their contribution in elucidating the “GPS of the brain”. Explore how this positioning system was deciphered, what the individual components of this system are, and how they integrate together to help us in our spatial memory and navigation.

The postThe Brain’s GPS — Unraveling the Functioning of Our Navigation Systemfirst appeared onBioradiations.]]>

Biomarker Profiling in Diabetes and Cardiovascular Disease

Bioradiations Staff

In this presentation, Dr. James Mapes details how Bio-Plex Pro™ Human RBM Metabolic and Hormone Assays can be used to assess multiple protein biomarkers associated with diabetes and metabolic conditions linked to cardiovascular diseases. Learn what biomarkers are currently under investigation and why rigorous assay validation is critical.

The postBiomarker Profiling in Diabetes and Cardiovascular Diseasefirst appeared onBioradiations.]]>

Using Droplet Digital™ PCR to Monitor Environmental Contaminants in Water

Bioradiations Staff

South of Los Angeles, near some of America’s most famous beaches, one small agency is working on new methods for coastal water monitoring. Watch this video and see how scientists from SCCWRP, the Southern California Coastal Water Research Project, are using Droplet Digital PCR to watch over swimmer safety and ensure a clean environment.

The postUsing Droplet Digital™ PCR to Monitor Environmental Contaminants in Waterfirst appeared onBioradiations.]]>

Protecting Coastal Ecosystems with Droplet Digital™ PCR

Bioradiations Staff

Who’s watching over swimmer safety at America’s beaches? Go inside one agency tasked with pioneering new methods for water quality monitoring, and see how its scientists are employing Droplet Digital PCR technology to check coastal waters for harmful pathogens.

The postProtecting Coastal Ecosystems with Droplet Digital™ PCRfirst appeared onBioradiations.]]>

Using the ChemiDoc Touch Imaging System to Find Leukemia Targets at UCSF

Bioradiations Staff

Discover how researcher Ernesto Diaz-Flores uses the ChemiDoc Touch Imaging System as he investigates therapeutic targets for a subtype of childhood leukemia. An avid photographer, Diaz-Flores also talks about the links between his art and his science, and the technologies that help him in both fields.

The postUsing the ChemiDoc Touch Imaging System to Find Leukemia Targets at UCSFfirst appeared onBioradiations.]]>

NGC System Tour and Configurator

Bioradiations Staff

The NGC Chromatography System introduces a new level of modularity and usability for protein purification. The modular design of the NGC System provides multiple configurations, each addressing different requirements. Use our configurator tool to build your own system to meet your specific workflow and throughput needs.

The postNGC System Tour and Configuratorfirst appeared onBioradiations.]]>

Bio-Rad’s S3 Cell Sorter Development: Redesigning Cell Sorting Technology

Bioradiations Staff

Take a look into the development of Bio-Rad’s S3 Cell Sorter, and see the fresh approach to cell sorting technology that resulted in an innovative new design.

The postBio-Rad’s S3 Cell Sorter Development: Redesigning Cell Sorting Technologyfirst appeared onBioradiations.]]>

Modeling Natural Killer Cell Receptors with the NGC Chromatography System

Bioradiations Staff

See how researcher Petr Novák, a structural biologist in Prague, Czech Republic, has accelerated his effort to characterize complex receptor molecules by integrating the NGC chromatography system into his lab’s workflow.

The postModeling Natural Killer Cell Receptors with the NGC Chromatography Systemfirst appeared onBioradiations.]]>

Bio-Rad Science Ambassador Program Reaches New Age Groups, More Schools

Bioradiations Staff

The Science Ambassador Program continues to grow in its mission to connect working scientists with students at the elementary, middle, and high school level. This month, bioradiations catches up with Bio-Rad’s corporate citizenship initiative at two events: the USA STEM festival in Washington, D.C., and a special day of science in Bio-Rad’s home town, Hercules, CA.

The postBio-Rad Science Ambassador Program Reaches New Age Groups, More Schoolsfirst appeared onBioradiations.]]>

Trends in Protein Separation and Analysis — the Advance of Stain-Free Technology

Bioradiations Staff

What is stain-free technology? How does it work in electrophoresis and western blotting? How does it compare with existing staining techniques? What are its advantages and possible concerns? Here is a technical review of this rapidly growing technological advance.

The postTrends in Protein Separation and Analysis — the Advance of Stain-Free Technologyfirst appeared onBioradiations.]]>

Telling the Story of Western Blots with the ChemiDoc Touch Imaging System

Bioradiations Staff

For a long time X-ray film has been the standard for imaging western blots, but this method has its limitations. Find out how 3 researchers are using the digital tools offered by the new ChemiDoc Touch Imaging System to beat these limitations and improve their blot images.

The postTelling the Story of Western Blots with the ChemiDoc Touch Imaging Systemfirst appeared onBioradiations.]]>

ZOE™ Fluorescent Cell Imager

Bioradiations Staff

Launch the ZOE Interactive Web App to try the intuitive ZOE user interface, manipulate images, view features and specifications in depth, and more.

The postZOE™ Fluorescent Cell Imagerfirst appeared onBioradiations.]]>

Advanced Topics in Cell Sorting

Bioradiations Staff

In this presentation by Dan Fox of Propel Labs, learn the principles of droplet-based cell sorting, how sorting speed affects results, and how to assess cell sorter performance. Modes and advantages of the S3™ Cell Sorter are also covered.

The postAdvanced Topics in Cell Sortingfirst appeared onBioradiations.]]>

Purification Trends: How Smart is Chromatography Automation?

Bioradiations Staff

What does automated protein purification mean today? What might it look like tomorrow? Bioradiations talks to a variety of users about what they’re doing now to implement automation in their purification processes, and what possibilities they envision that will improve chromatography in the near future.

The postPurification Trends: How Smart is Chromatography Automation?first appeared onBioradiations.]]>

Troubleshooting the Bio-Plex® 200 Multiplex Immunoassay System: Device Time-Out

Bioradiations Staff

A “device time-out” message on the Bio-Plex^®200 System occurs when the instrument’s needle or probe cannot move correctly. Watch this video for several troubleshooting steps to try when this message occurs.

The postTroubleshooting the Bio-Plex^®200 Multiplex Immunoassay System: Device Time-Outfirst appeared onBioradiations.]]>

Multiplex Analysis of Cell Death Markers Using Bio-Plex Pro™ RBM Apoptosis Assays

Bioradiations Staff

Bio-Rad’s new Bio-Plex Pro RBM Apoptosis Multiplex Assays enable complex, quantitative analyses of biomarkers in the intrinsic apoptosis pathway. Learn more about these biomarkers and view sample data and performance characteristics of these assays in this detailed technical report.

The postMultiplex Analysis of Cell Death Markers Using Bio-Plex Pro™ RBM Apoptosis Assaysfirst appeared onBioradiations.]]>

Genomic Variation Analysis with Droplet Digital PCR: Success Stories

Bioradiations Staff

Researchers are having success applying Droplet Digital PCR (ddPCR™）technology across many different fields. Here are two such success stories, one involving the application of ddPCR in detecting mutations in iPS cells, the other in predicting allele-specific variation in human brain development.

The postGenomic Variation Analysis with Droplet Digital PCR: Success Storiesfirst appeared onBioradiations.]]>

Brighter Precision Plus Protein™ Dual Color Standard — The Brightest Protein Marker Available

Bioradiations Staff

Take a quick look at Bio-Rad’s brighter Precision Plus Protein™ Dual Color Standard with this article comparing this standard to other available protein markers. Plus, find out why the ability to visualize a protein standard after reprobing matters to one researcher!

The postBrighter Precision Plus Protein™ Dual Color Standard — The Brightest Protein Marker Availablefirst appeared onBioradiations.]]>

Better, Faster, and Less Expensive Gene Expression Analysis Using Multiplex One-Step RT-qPCR: A Case Study of Colorectal Cancer

Bioradiations Staff

Conducting a triplex one-step RT-qPCR assay promises a more efficient and economical analysis of gene expression compared to running three individual assays. This technical report describes a colorectal cancer case study where a triplex multiplex assay was validated.

The postBetter, Faster, and Less Expensive Gene Expression Analysis Using Multiplex One-Step RT-qPCR: A Case Study of Colorectal Cancerfirst appeared onBioradiations.]]>

Troubleshooting the Bio-Plex® 200 Multiplex Immunoassay System: HTF Alarm

Bioradiations Staff

The high-throughput fluidics (HTF) alarm on the Bio-Plex^®200 System indicates a problem with the instrument’s sheath fluid delivery system. See the actions needed to quickly resolve potential issues with this system and get back to your research!

The postTroubleshooting the Bio-Plex^®200 Multiplex Immunoassay System: HTF Alarmfirst appeared onBioradiations.]]>

Troubleshooting the Bio-Plex® 200 Multiplex Immunoassay System: Device Failed to Pressurize

Bioradiations Staff

During calibration of your Bio-Plex^®200 System, you may receive a “failed to pressurize message.” In this short video, get some easy fixes for the most common issues prompting this message.

The postTroubleshooting the Bio-Plex^®200 Multiplex Immunoassay System: Device Failed to Pressurizefirst appeared onBioradiations.]]>

How to Remove Stripes from a Gel Image — ChemiDoc™ Imager Filter Alignment

Bioradiations Staff

Usually when stripes appear on a gel image produced with a ChemiDoc XRS+ or ChemiDoc MP Imaging System, a misaligned filter is the cause. Learn the simple steps to correct this issue with this video from Bench Partners.

The postHow to Remove Stripes from a Gel Image — ChemiDoc™ Imager Filter Alignmentfirst appeared onBioradiations.]]>

Ligand Immobilization in Protein Interaction Studies — An Unattended Amine Coupling Protocol with Automatic Coinjection Activation

Bioradiations Staff

Amine coupling is the most commonly adopted technique to bind proteins to biosensor chips. Because of the possibility of the amine coupling reagents reacting with each other, these have to be premixed just before the injection and injected independently. Here are some tips to automatically coinject these reagents.

The postLigand Immobilization in Protein Interaction Studies — An Unattended Amine Coupling Protocol with Automatic Coinjection Activationfirst appeared onBioradiations.]]>

Bio-Rad’s Universal Real-Time PCR App – Everything You Need to Know about Real-Time PCR at Your Fingertips

Bioradiations Staff

Bio-Rad’s Universal Real-Time PCR Kits and Reagents work on all real-time PCR systems. Now you can easily compare performance data and get supporting documents for these kits and reagents using Bio-Rad’s new tablet and web app. Learn more and download the app here.

The postBio-Rad’s Universal Real-Time PCR App – Everything You Need to Know about Real-Time PCR at Your Fingertipsfirst appeared onBioradiations.]]>

Developing Bio-Rad’s S3™ Cell Sorter: The Great Cell Sorting Redesign

Bioradiations Staff

Cell sorting technology is not new. However, sometimes taking a new look at a mature technology brings unexpected results. See how we reimagined drop delay calculation, rethought software and automation, and more during the design and development of Bio-Rad’s S3 Cell Sorter.

The postDeveloping Bio-Rad’s S3™ Cell Sorter: The Great Cell Sorting Redesignfirst appeared onBioradiations.]]>

Protein Purification Workflow Development Using Bio-Rad’s NGC™ Chromatography System

Bioradiations Staff

While using affinity tagging is the preferred method to achieve highly pure protein through recombinant expression, this approach isn’t feasible for all proteins. This tech report describes workflow optimizations using the NGC Chromatography System that allow users to achieve high purities with untagged proteins.

The postProtein Purification Workflow Development Using Bio-Rad’s NGC™ Chromatography Systemfirst appeared onBioradiations.]]>

Single-Cell Western Blot and Stain-Free Total Protein Loading Control

Bioradiations Staff

Dr. Robyn Murphy of Latrobe University introduces a protocol using Bio-Rad’s stain-free gel technology to conduct western blotting on sample sizes as small as single muscle cells. Dr. Murphy shows how this reliable western blotting method can be a valuable research tool. Learn more about stain-free technology.

The postSingle-Cell Western Blot and Stain-Free Total Protein Loading Controlfirst appeared onBioradiations.]]>

Can We Trust Western Blots?

Bioradiations Staff

Prof. Aldrin Gomes of UC Davis shares western blot problems he has seen as a journal editor and outlines standardized procedures and controls needed to make western blotting data reliable. The presentation also includes tips to save time and labor during the blotting procedure.

The postCan We Trust Western Blots?first appeared onBioradiations.]]>

Unlocking the Structures of Natural Killer Cell Receptors with the NGC™ Chromatography System

Bioradiations Staff

Structural biologist Petr Novák employs the latest techniques to model natural killer cell receptor molecules, research that may one day result in powerful therapies to treat cancer and infections. Go inside the fascinating world of structural characterization and find out how Novák has integrated the NGC™ chromatography system into his effort to visualize these molecules in vivid detail.

The postUnlocking the Structures of Natural Killer Cell Receptors with the NGC™ Chromatography Systemfirst appeared onBioradiations.]]>

Novel Liposome-Capture Surface Chemistries to Analyze Drug-Lipid Interaction Using the ProteOn™ XPR36 System

Bioradiations Staff

Surface plasmon resonance (SPR) biosensors offer a label-free technique for profiling biomolecular interactions, including those between drugs and liposomes. Here we describe the novel surface chemistries that make capturing liposomes possible, and explore the application of the liposome capturing kit in analyzing liposome-small molecule interactions.

The postNovel Liposome-Capture Surface Chemistries to Analyze Drug-Lipid Interaction Using the ProteOn™ XPR36 Systemfirst appeared onBioradiations.]]>

DIY Cell Sorting with Bio-Rad’s S3™ Cell Sorter

Bioradiations Staff

Until recently, cell sorting has been a complex endeavor requiring specialized facilities and trained technicians. This infographic reveals how Bio-Rad’s S3 cell sorter makes this technique available to individual, non-expert researchers in 3 easy steps.

The postDIY Cell Sorting with Bio-Rad’s S3™ Cell Sorterfirst appeared onBioradiations.]]>

TC20™ and TC10™ Cell Counters – Cleaning the Print Heads for Clear Printed Results

Bioradiations Staff

Most problems with misaligned printouts on the printer supplied with the TC20 and TC10 cell counters can be solved by cleaning the print heads. In this short video, find out the fast, easy, and effective way to clean these print heads so you can get back to your research!

The postTC20™ and TC10™ Cell Counters – Cleaning the Print Heads for Clear Printed Resultsfirst appeared onBioradiations.]]>

两路支撑中心-安装到地面

Bioradiations Staff

Learn the best practices and tips for setting up your Bio-Rad Supply Center。

The post两路支撑中心-安装到地面first appeared onBioradiations.]]>

The Ever-Expanding Universe of Droplet Digital™ PCR Applications

Bioradiations Staff

Bio-Rad’s groundbreaking Droplet Digital^™，™PCR technology can be applied in a variety of applications to glean precious information that cannot be obtained by any other method. Find out more about how this technology has been used in applications such as quantification of cancer biomarkers, validation of next generation sequencing, distinguishing genomic variation, and more.

The postThe Ever-Expanding Universe of Droplet Digital™ PCR Applicationsfirst appeared onBioradiations.]]>

Bio-Rad Supply Center-How-To Tips for Taking Inventory

Bioradiations Staff

In this new video series，Bio-Rad offers answers for some your most frequently asked questions.This installment covers setting up and taking inventory of your Bio-Rad Supply Center。

The postBio-Rad Supply Center-How-To Tips for Taking Inventoryfirst appeared onBioradiations.]]>

Transforming Cancer Research: Droplet Digital PCR Plays Integral Role at Fred Hutchinson Cancer Research Center

Bioradiations Staff

Droplet Digital PCR has major implications for cancer studies, where the ability to accurately measure biomarkers may result in important insights into cancer genesis and progression. Find out about new findings on micro RNA and Tumor Infilitrating Lymphocytes made possible by ddPCR technology.

The postTransforming Cancer Research: Droplet Digital PCR Plays Integral Role at Fred Hutchinson Cancer Research Centerfirst appeared onBioradiations.]]>

A New Breed of Cell Sorters: Bio-Rad’s S3™ Cell Sorter Appeals to the Growing Cell Biology Community

Bioradiations Staff

The S3 cell sorter is Bio-Rad’s new addition to the world of flow cytometry. Take a look at how this instrument breaks the mold for cell sorters, brings relief to investigators and core lab managers alike, and opens up exciting new research possibilities.

The postA New Breed of Cell Sorters: Bio-Rad’s S3™ Cell Sorter Appeals to the Growing Cell Biology Communityfirst appeared onBioradiations.]]>

Bio-Plex® Assay Builder

Bioradiations Staff

Design your customized Express or x-Plex assay, process your catalog number, and obtain pricing information, launch the Assay Builder

The postBio-Plex^®Assay Builderfirst appeared onBioradiations.]]>

Applications of Bio-Plex Pro™ Cell Signaling Akt and MAPK Assay Panels in Signal Transduction Pathways

Bioradiations Staff

The Akt and MAPK signal transduction pathways are key areas of study for their roles in cell growth, function, and death, as well as for their possible roles in cancer development and diabetes. Bio-Rad’s new Bio-Plex Pro™ Akt and MAPK cell signaling assays enable researchers to study the activation of these key pathways as a response to various stimuli. This technical report validates the sensitivity and specificity of these assays after cells were exposed to insulin, EGF (epidermal growth factor), and UV radiation.

The postApplications of Bio-Plex Pro™ Cell Signaling Akt and MAPK Assay Panels in Signal Transduction Pathwaysfirst appeared onBioradiations.]]>

Profiling Dynamic Cancer Drug Responses with BioMarker Strategies, LLC and the Bio-Plex® Multiplex Immunoassay System

Bioradiations Staff

In an age of personalized medicine, getting the most out of highly targeted cancer therapies takes finding the best molecular targets for each patient. BioMarker Strategies LLC, a small startup, has been developing an innovative method to do this by modeling oncogenic pathway responses, but they needed to accurately measure the levels of phosphoproteins resulting from the activation of these genes. Learn how they are using the Bio-Plex multiplex immunoassay system to accurately quantify the proteins and generate functional signaling profiles for these oncogenes.

The postProfiling Dynamic Cancer Drug Responses with BioMarker Strategies, LLC and the Bio-Plex^®Multiplex Immunoassay Systemfirst appeared onBioradiations.]]>

Droplet Digital™ PCR for Gene Expression and MicroRNA Analysis

Bioradiations Staff

Join Dr. Yann Jouvenot for this overview of Bio-Rad's Droplet Digital PCR (ddPCR™）System. Learn about the principles, unique characteristics, and applications of the technology and find out how it can be used to complement existing techniques in gene expression studies and microRNA analysis.

The postDroplet Digital™ PCR for Gene Expression and MicroRNA Analysisfirst appeared onBioradiations.]]>

Life Since the Double Helix: 60 Years of Evolution in Biotechnology

Bioradiations Staff

The advances in biological science and its applications in medicine, industry, agriculture, and other fields over the past 60 years have changed the world dramatically. This article highlights the major milestones in biology and biotechnology since the discovery of the DNA double helix.

The postLife Since the Double Helix: 60 Years of Evolution in Biotechnologyfirst appeared onBioradiations.]]>

Casting Polyacrylamide Gels with TGX™ and TGX Stain-Free™ FastCast™ Acrylamide Kits

Bioradiations Staff

Want a streamlined, easy workflow for hand casting polyacrylamide gels? This tutorial video shows how to use Bio-Rad’s new FastCast™ acrylamide kits to hand cast gels, saving time while providing the benefits of the latest precast gel chemistries.

The postCasting Polyacrylamide Gels with TGX™ and TGX Stain-Free™ FastCast™ Acrylamide Kitsfirst appeared onBioradiations.]]>

Microbes in Space! High School Students Design Experiments for the International Space Station with Bio-Rad’s pGLO™ Bacterial Transformation Kits

Bioradiations Staff

Retired satellite engineer Dan Saldana is helping Valley Christian High School in San Jose, CA build a program to send student experiments to the International Space Station. To study microbial growth in microgravity, Saldana and his students turned to Bio-Rad’s pGLO bacterial transformation kits. Learn about the high-flying travels of these glowing bacteria and the science learning that resulted.

The postMicrobes in Space! High School Students Design Experiments for the International Space Station with Bio-Rad’s pGLO™ Bacterial Transformation Kitsfirst appeared onBioradiations.]]>

Droplet Digital™ PCR for Gene Copy Number Variation Analysis

Bioradiations Staff

In this webinar presented by Dr. Jennifer Berman, learn how Droplet Digital PCR (ddPCR™）technology uses a simple, cost-effective workflow to accurately and reproducibly assess copy number variations (CNVs) even in high-throughput settings.

The postDroplet Digital™ PCR for Gene Copy Number Variation Analysisfirst appeared onBioradiations.]]>

Building New Anti-HIV Molecules with Bio-Rad’s ProteOn™ XPR36 System

Bioradiations Staff

Can we construct molecules that will interfere with disease pathways? Dan Mitchell of the University of Warwick and his colleagues wanted to apply new synthesis techniques to interrupting HIV infection. Find out what they learned about the potential of these novel molecules using Bio-Rad’s ProteOn™ XPR36 System.

The postBuilding New Anti-HIV Molecules with Bio-Rad’s ProteOn™ XPR36 Systemfirst appeared onBioradiations.]]>

The Chromatography Chronicles Part 5: Chromatography You Can Count On

Bioradiations Staff

In biochromatography, every purification or separation procedure that fails because of instrument malfunction wastes precious lab resources. That’s why Bio-Rad, in designing the NGC chromatography system, found new ways to engineer reliability into the chromatography experience. Here’s how they did it.

The postThe Chromatography Chronicles Part 5: Chromatography You Can Count Onfirst appeared onBioradiations.]]>

Bio-Rad’s FastCast™ Acrylamide Kits — It’s Time to Expect More from Your Handcast Gels

Bioradiations Staff

Hand casting polyacrylamide gels is not an easy task. It is laborious, needs lot of pre-planning and is cumbersome. Bio-Rad’s new TGX and TGX Stain-Free FastCast gel solutions not only address all these issues, but provide added benefits, such as increased speed, stain-free visualization, and quality control. Learn more about these new handcasting kits.

The postBio-Rad’s FastCast™ Acrylamide Kits — It’s Time to Expect More from Your Handcast Gelsfirst appeared onBioradiations.]]>

Stand Up Against Downtime

Bioradiations Staff

Facing adversity with humor, some chromatographers are drawing on the healing power of laughter to deal with the frustrations of chromatography systems that just won’t work.

The postStand Up Against Downtimefirst appeared onBioradiations.]]>

Using Droplet Digital™ PCR for Cancer and Liquid Biopsy Studies

Bioradiations Staff

This presentation by Dr. Dawne Shelton describes how Droplet Digital PCR (ddPCR™）can be used to measure circulating nucleic acids (cfDNA) and circulating tumor cells (CTCs) in blood and to detect rare tumorigenic mutations down to 0.01% or less in a high background of normal DNA. Techniques and methods discussed in this webinar will enable you to begin your own investigations.

The postUsing Droplet Digital™ PCR for Cancer and Liquid Biopsy Studiesfirst appeared onBioradiations.]]>

The Power of Partitioning: The World of Droplet Digital™ PCR Applications

Bioradiations Staff

Droplet Digital PCR (ddPCR™）has revolutionized infectious disease research, cancer biomarker and genomic variation analysis, and other fields. This webinar by Dr. George Karlin-Neumann provides an overview of the ddPCR concept and workflow and discusses recent journal publications showcasing the technology’s diverse applications.

The postThe Power of Partitioning: The World of Droplet Digital™ PCR Applicationsfirst appeared onBioradiations.]]>

The Aha！Moment–Bio Rad Science Ambassadors at the 2013 Day of Innovation

Bioradiations Staff

Enthusiastic students describe the fun they had with the Science Ambassador DNA experiment。

The postThe Aha！Moment–Bio Rad Science Ambassadors at the 2013 Day of Innovationfirst appeared onBioradiations.]]>

Learning Curve Blues

Bioradiations Staff

This researcher sings a tune many will recognize from their own frustrations with overly complex chromatography instruments. The NGC™ chromatography system offers a simple, user-friendly interface so even students with little experience will beat the “learning curve blues.”

The postLearning Curve Bluesfirst appeared onBioradiations.]]>

Efficient SPR-Based Fragment Screening and Small Molecule Affinity Analysis Using Bio-Rad’s ProteOn™ XPR36 System

Bioradiations Staff

Fragment-based screening has emerged as an important tool for identifying lead compounds in drug discovery, though the molecules involved present challenges related to their low affinity. Label-free surface plasmon resonance (SPR) analysis provides an efficient and reproducible solution to these challenges. Here we describe ways to determine small molecule affinity that combines high sensitivity and high throughput with low sample consumption.

The postEfficient SPR-Based Fragment Screening and Small Molecule Affinity Analysis Using Bio-Rad’s ProteOn™ XPR36 Systemfirst appeared onBioradiations.]]>

The Chromatography Chronicles Part 4: Chromatography’s Intuitive Side

Bioradiations Staff

Chromatography instruments have a bad reputation in terms of their complexity and difficulty of use. In response, Bio-Rad’s designers and engineers challenged themselves to make the new NGC™ chromatography system as simple and intuitive-to-use as possible. Learn about the new easier-to-use instrument interface they created as a result.

The postThe Chromatography Chronicles Part 4: Chromatography’s Intuitive Sidefirst appeared onBioradiations.]]>

Labs for Inspiration: Making a Difference with Bio-Rad’s Science Ambassador Program

Bioradiations Staff

Jefferson County, Tennessee, faced tight school budgets and a mandate to “teach to the test” that left little room for hands-on science learning. Learn how biology professor Lisa Eccles worked to reverse this trend by getting involved with the Science Ambassador program, Bio-Rad’s fast-growing initiative to spark excitement about life science in primary school classrooms.

The postLabs for Inspiration: Making a Difference with Bio-Rad’s Science Ambassador Programfirst appeared onBioradiations.]]>

Breaking Leukemia’s Limits of Detection with Droplet Digital™ PCR

Bioradiations Staff

Prof. Alec Morley, a pioneer in digital PCR, describes his use of Droplet Digital PCR (ddPCR™）technology to advance the diagnosis and treatment of leukemia. Morley and his colleagues at Flinders University and Medical Center in Adelaide, South Australia previously developed a digital PCR method for the early detection of residual acute lymphoblastic leukemia (ALL). Learn how Morley is now using Bio-Rad's ddPCR technology to develop a diagnostic test for monitoring chronic myeloid leukemia.

The postBreaking Leukemia’s Limits of Detection with Droplet Digital™ PCRfirst appeared onBioradiations.]]>

Breaking Leukemia’s Limits of Detection with Droplet Digital PCR

Bioradiations Staff

In the early 1990s, researcher Alec Morley and his colleagues pioneered digital PCR techniques to measure acute lymphoblastic leukemia. Today, Morley is trying to develop a more accurate way to quantify chronic myeloid leukemia. Find out why he chose Bio-Rad’s Droplet Digital PCR technology for this effort.

The postBreaking Leukemia’s Limits of Detection with Droplet Digital PCRfirst appeared onBioradiations.]]>

Bench Buzz – Protein Purification Product Testers

Bioradiations Staff

Meet Janna and Tomas. After hearing competing claims about the scalability of next-generation chromatography systems, this dynamic duo took it upon themselves to discover the truth. Now let's face it, when you think of protein purification you don't usually think of good times. But somehow Janna and Tomas manage to keep the mood light even as they put the systems to the test by simulating changing protein purification needs. Their conclusion? Vote Yes for Better Chromatography. Vote Yes for Bio-Rad.

The postBench Buzz – Protein Purification Product Testersfirst appeared onBioradiations.]]>

The Chromatography Chronicles Part 3: Adding, Swapping, and Scaling — Better Chromatography through Modular Design

Bioradiations Staff

What does it take to configure your own chromatography system? Part three of The Chromatography Chronicles examines how the NGC™ chromatography system adapts and grows to meet changing lab needs, and the modular design that makes this possible.

The postThe Chromatography Chronicles Part 3: Adding, Swapping, and Scaling — Better Chromatography through Modular Designfirst appeared onBioradiations.]]>

2-D Electrophoresis Tips & Tricks — Part I

Bioradiations Staff

In the first half of this two-part presentation, Dr. Anton Posch, an expert in 1- and 2-D electrophoresis, provides tips and tricks for the 2DE workflow, covering sample preparation, protein extraction and solubilization, reduction and alkylation of protein side chains, and IEF. The webinar highlights critical success factors and is aimed at both novices and experts wanting to sharpen their skills and keep up on new advances in the field.

The post2-D Electrophoresis Tips & Tricks — Part Ifirst appeared onBioradiations.]]>

2-D Electrophoresis Tips & Tricks — Part II

Bioradiations Staff

In the second part of this presentation, Dr. Posch details IEF separation, use of immobilized pH gradient (IPG) strips, running second-dimension PAGE, spot detection, gel matching, and data analysis. The Q&A elaborates on sample preparation, storage, and running conditions.

The post2-D Electrophoresis Tips & Tricks — Part IIfirst appeared onBioradiations.]]>

Buying a New Preparative Protein Purification System – You Have a New Choice

Bioradiations Staff

A day in the life of Maria, a post-graduate scientist. Both Maria and her PI are annoyed with their unreliable, out-dated protein purification system, and her PI asks Maria to buy them a new one. She struggles to find a system that meets all their needs until she remembers that Bio-Rad has a new next-generation chromatography system that will work for everyone!

The postBuying a New Preparative Protein Purification System – You Have a New Choicefirst appeared onBioradiations.]]>

Guide to SPR Data Processing on the ProteOn™ XPR36 System

Bioradiations Staff

Good data processing practice ensures that protein interaction experiments using a surface plasmon resonance (SPR) system will yield the clearest possible results. Here we present tips for understanding and processing SPR sensorgrams when using Bio-Rad’s ProteOn™ XPR36 protein interaction array system.

The postGuide to SPR Data Processing on the ProteOn™ XPR36 Systemfirst appeared onBioradiations.]]>

The Chromatography Chronicles Part 2: The Chromatographers Who Came in from the Cold

Bioradiations Staff

Is spending hours in the coldroom just an inevitable part of doing chromatography? The engineers and designers at Bio-Rad believed that, with a little innovation, the answer could be “no.” Part two of The Chromatography Chronicles reveals how they freed the NGC™ medium-pressure chromatography system — and its users — from the coldroom’s chilly confines.

The postThe Chromatography Chronicles Part 2: The Chromatographers Who Came in from the Coldfirst appeared onBioradiations.]]>

Biologics Analysis Workflow™ – Delivering Increased Throughput, Sensitivity, Reproducibility, and Automation for cGMP Laboratories

Bioradiations Staff

Evaluating potential protein therapies for purity and/or identity represents a vital and highly regulated step in biological drug development. Bio-Rad’s new Biologics Analysis Workflow™ offers a high-throughput, sensitive, and reproducible solution that is cGMP-compliant.

The postBiologics Analysis Workflow™ – Delivering Increased Throughput, Sensitivity, Reproducibility, and Automation for cGMP Laboratoriesfirst appeared onBioradiations.]]>

Bio-Rad Expert Care — New Service Plans from Bio-Rad’s Service Team

Bioradiations Staff

A high quality lab instrument represents a major investment for any researcher. With its new Expert Care service program, Bio-Rad now offers a slate of service plans so its customers can rest assured that their valuable equipment will receive prompt, high-quality support and service at the right level for their needs. Learn about the different options available under the Expert Care service program.

The postBio-Rad Expert Care — New Service Plans from Bio-Rad’s Service Teamfirst appeared onBioradiations.]]>

Using Droplet Digital™ PCR to Study Stem Cell Genomes at Stanford University

Bioradiations Staff

In this webinar, Prof. Alexander Urban of the Stanford School of Medicine describes how his lab used the QX200™ Droplet Digital™ PCR System to investigate copy number variation (CNV) in induced pluripotent stem cells (iPSCs) that were being used to study the genetics of autism.

The postUsing Droplet Digital™ PCR to Study Stem Cell Genomes at Stanford Universityfirst appeared onBioradiations.]]>

Can Droplet Digital™ PCR Detect 22q11.2 Deletion Syndrome?

Bioradiations Staff

This presentation by Vicki Hwang details how UC Davis researchers used Droplet Digital PCR (ddPCR™）technology to determine copy number variation (CNV) and characterize the deletion endpoints of the region of chromosome 22 that is deleted in 22q11 deletion syndrome.

The postCan Droplet Digital™ PCR Detect 22q11.2 Deletion Syndrome?first appeared onBioradiations.]]>

PrimePCR ddPCR CNV Assay Validation Data

Bioradiations Staff

Gene Name BRCA1 Gene Symbol BRCA1 Species Human Summary breast cancer 1, early onset [Source:HGNC Symbol;Acc:1100] Gene Aliases BRCC1:PPP1R53:RNF53 RefSeq Accession No. NM_007294.3:NM_007299.3:NM_007297.3:NM_007300.3 UniGeneID Hs.194143 Ensemble Gene ID ENSG00000012048 Entrez Gene ID 672 Unique Assay ID dHsaCP1000008 MiQE Context Sequence GTGAAATAAAAGGTAGTATGAGTTCCATCAAGGTGCTTACAGTCTA ATTTAAGGAGACAATGAACCACAAACAATTGTGCCATTAATTCAAA GAGATGATGTCAGCAAACCTAAGAATGTGGG Amplicon Length 82nt Chromosome Location chr17: 41242773-41242895 Probe Fluorophore FAM Assay Design CNV Assay Probe Purification HPLC Primer Purification Desalted Instrument QX200 ddPCR System Supermix QX200 ddPCR Supermix for Probes Assay Specificity > 90% specificity

The postPrimePCR ddPCR CNV Assay Validation Datafirst appeared onBioradiations.]]>

Guide to SPR Data Analysis on the ProteOn™ XPR36 System

Bioradiations Staff

Analyzing protein interaction data using a surface plasmon resonance (SPR) system can be complicated. This user guide describes how to analyze SPR data to obtain kinetic and equilibrium constants, as well as sample concentrations.

The postGuide to SPR Data Analysis on the ProteOn™ XPR36 Systemfirst appeared onBioradiations.]]>

Vote Yes for Better Chromatography — The Results Are In!

Bioradiations Staff

Watch the protein purification election night special parody! Find out which chromatography system wins. Laugh Out Loud at the terrible protein purification "pundit" and Vote Yes for Better Chromatography "Fanatics." Learn what values and system features were appreciated most by voters.

The postVote Yes for Better Chromatography — The Results Are In!first appeared onBioradiations.]]>

New PrimePCR™ Probe Assays for Real-time PCR and Droplet Digital™ PCR Technologies

Bioradiations Staff

Bio-Rad’s PrimePCR probe assays gave researchers a powerful, reliable set of investigative tools utilizing SYBR® Green detection chemistry. Now Bio-Rad is adding a number of new assays to the PrimePCR portfolio, bringing the benefits of PrimePCR assays to many new applications for both real-time PCR and Droplet Digital™ PCR platforms.

The postNew PrimePCR™ Probe Assays for Real-time PCR and Droplet Digital™ PCR Technologiesfirst appeared onBioradiations.]]>

The Chromatography Chronicles Part 1: The Votes Are in — Customer Voices and the NGC Chromatography System Design Process

Bioradiations Staff

Whether through unreliability, lack of workflows, or poor design, chromatography systems can cause major hassles for any lab involved in purifying proteins. Would Bio-Rad be able to solve these longstanding problems? This new series takes an inside look at the development of the NGC medium-pressure chromatography system. This month: bringing customers into the design process.

The postThe Chromatography Chronicles Part 1: The Votes Are in — Customer Voices and the NGC Chromatography System Design Processfirst appeared onBioradiations.]]>

Options for Dataset Export Using the ProteOn Manager™ Software

Bioradiations Staff

This appendix to “Guide to SPR Data Analysis on the Proteon™ XPR36 System” gives information on the data set export using ProteOn Manager™ Software.

The postOptions for Dataset Export Using the ProteOn Manager™ Softwarefirst appeared onBioradiations.]]>

Digital Quantitation of Potential Therapeutic Target RNAs

Bioradiations Staff

In this webinar, Dr. David Dodd describes how he and Prof. David Corey and colleagues at UT Southwestern Medical Center have used Droplet Digital™ PCR (ddPCR™）in their research into low-abundance targets with therapeutic potential for cancer and Huntington’s disease.

The postDigital Quantitation of Potential Therapeutic Target RNAsfirst appeared onBioradiations.]]>

Revealing BRCA2 Pathways in Cancer with Bio-Rad’s V3 Western Workflow™

Bioradiations Staff

Research led by Prof. Ryan Jensen at Yale Medical School focuses on elucidating the links between BRCA gene mutations and breast cancer. Learn how researchers in his lab use Bio-Rad's V3 Western Workflow to study interactions between BRCA proteins and the DNA repair protein RAD51. Understanding how these proteins interact in carcinogenesis and tumor growth will provide a new understanding of breast cancer mechanisms that could lead to new therapies.

The postRevealing BRCA2 Pathways in Cancer with Bio-Rad’s V3 Western Workflow™first appeared onBioradiations.]]>

Revealing BRCA2 Pathways in Cancer with Bio-Rad’s V3 Western Workflow

Bioradiations Staff

Twenty years after the discovery of the link between BRCA gene mutations and breast cancer, researcher Ryan Jensen of the Yale Medical School is looking into the interactions between the DNA repair protein RAD51 and BRCA proteins using Bio-Rad’s V3 Western Workflow.

The postRevealing BRCA2 Pathways in Cancer with Bio-Rad’s V3 Western Workflowfirst appeared onBioradiations.]]>

Reliable, Streamlined 2-D Western Blot Workflow for Evaluation of Antibodies Developed for Detection of Host Cell Proteins

Bioradiations Staff

Removing host cell protein (HCP) contaminants represents an essential step in the production of biologics (therapeutic protein drugs), but has long been a time- and labor-intensive process. Here, we demonstrate a simpler, quicker, and more standardized workflow for evaluating anti-HCP antibodies using 2-D electrophoresis and western blotting.

The postReliable, Streamlined 2-D Western Blot Workflow for Evaluation of Antibodies Developed for Detection of Host Cell Proteinsfirst appeared onBioradiations.]]>

T100™ Thermal Cycler – Endorsed by Customers around the World

Bioradiations Staff

Life science researchers all over the world use the T100 thermal cycler in their daily routine. In this video, users describe how it saves them time and helps them consistently obtain high-quality data.

The postT100™ Thermal Cycler – Endorsed by Customers around the Worldfirst appeared onBioradiations.]]>

Bio-Rad’s Applications & Technologies Pages: A Valuable Resource for Scientists

Bioradiations Staff

Discover the wide range of applications for Bio-Rad products in diverse fields of study and learn more about our cutting-edge technologies and their underlying principles. Get protocols, troubleshooting tips, and updates on the latest developments in methods, instrumentation, and software.

The postBio-Rad’s Applications & Technologies Pages: A Valuable Resource for Scientistsfirst appeared onBioradiations.]]>

Using Bio-Rad’s PDQuest Software to Generate a Match Rate between 2-D Electrophoresis and Western Blotting

Bioradiations Staff

2-D electrophoresis followed by immunodetection of protein spots using western blotting is adopted commonly in proteomics studies. Here we present step-by-step instructions for obtaining accurate overlaps between the gel and the blot using the PDQuest 2-D gel analysis software.

The postUsing Bio-Rad’s PDQuest Software to Generate a Match Rate between 2-D Electrophoresis and Western Blottingfirst appeared onBioradiations.]]>

New and Improved Microplate Manager® Software for Microplate Data Acquisition and Analysis

Bioradiations Staff

Bio-Rad’s microplate readers function at their full potential when used with Microplate Manager Software. This updated version of the software features two new read modes, compatibility with the latest operating systems, and more.

The postNew and Improved Microplate Manager^®Software for Microplate Data Acquisition and Analysisfirst appeared onBioradiations.]]>

Real-Time PCR Interactive Tutorials — From Reagent Selection to Real-Time PCR Data Analysis

Bioradiations Staff

Obtaining accurate quantitative PCR data depends on choosing and validating the proper reagents for a given experiment. These new tutorials present the knowledge base needed to understand the parameters involved in reagent selection in order to get the best results from real-time PCR procedures.

The postReal-Time PCR Interactive Tutorials — From Reagent Selection to Real-Time PCR Data Analysisfirst appeared onBioradiations.]]>

Conservation Genetics: High School Students Use Biotechnology Explorer™ Products to Help Save California Redwoods

Bioradiations Staff

“If we want students to be biologists, let’s start being biologists,” says Ray Cinti, a science teacher at Convent of the Sacred Heart High School in San Francisco. Find out how Cinti’s class is accomplishing this by doing real research on Coast Redwoods genetic diversity using the Biotechnology Explorer Cloning and Sequencing Explorer series.

The postConservation Genetics: High School Students Use Biotechnology Explorer™ Products to Help Save California Redwoodsfirst appeared onBioradiations.]]>

Bio-Rad’s 2-D Electrophoresis Workflow How-To Guide, Fourth Edition, is Now Available for Download

Bioradiations Staff

Bio-Rad’s 2-D electrophoresis workflow offers better results in a shorter time. Take a detailed look at this workflow by downloading the updated edition of our How-To Guide.

The postBio-Rad’s 2-D Electrophoresis Workflow How-To Guide, Fourth Edition, is Now Available for Downloadfirst appeared onBioradiations.]]>

Digital PCR at the Next Level: Users Find Many Applications for the QX100™ Droplet Digital™ PCR System

Bioradiations Staff

The QX100 Droplet Digital PCR system gives researchers an improvement in PCR precision and sensitivity. See how this innovative digital PCR system is enabling companies to create better products, improve workflow efficiencies, and validate results with greater accuracy than previous methods allowed.

The postDigital PCR at the Next Level: Users Find Many Applications for the QX100™ Droplet Digital™ PCR Systemfirst appeared onBioradiations.]]>

Learning in their DNA: Inside the Bio-Rad Science Ambassador Program

Bioradiations Staff

Take a closer look at Bio-Rad's initiative to bring scientists into K–12 schools in North America by following three Ambassadors as they go into classrooms. Find out more about what this program offers students, teachers, and researchers.

The postLearning in their DNA: Inside the Bio-Rad Science Ambassador Programfirst appeared onBioradiations.]]>

PrimePCR™ PCR Primers & Assays

Bioradiations Staff

PrimePCR™ assays for real-time PCR and Droplet Digital™ PCR are expertly designed and experimentally validated for guaranteed performance. Ways to order PrimePCR assays: My PrimePCR Reorder previously ordered assays PrimePCR Product Page Search for a gene, disease, or pathway name Unique Assay ID Search for the ID found on the spec sheet

The postPrimePCR™ PCR Primers & Assaysfirst appeared onBioradiations.]]>

Investigating Protein Translation with the NGC™ Chromatography System

Bioradiations Staff

The Fraser lab at University of California Davis tested Bio-Rad’s NGC system for the purification of ribosomal complex proteins in their studies of protein translation mechanisms. The NGC system enabled these researchers to significantly increase their protein purification throughput and save valuable time in the lab.

The postInvestigating Protein Translation with the NGC™ Chromatography Systemfirst appeared onBioradiations.]]>

A Novel Biotinylated Ligand-Capture Method with Surface Regeneration Capability for Label-Free Biomolecular Interaction Analysis

Bioradiations Staff

Ligand-capture approaches using biotin as an affinity tag are often utilized in biomolecular interaction analyses with surface plasmon resonance (SPR) biosensors. However, a drawback to using biotin is that it makes surface regeneration of SPR sensor chips difficult. Here is a strategy that facilitates surface regeneration when using biotinylated ligand-capture approaches to SPR analysis.

The postA Novel Biotinylated Ligand-Capture Method with Surface Regeneration Capability for Label-Free Biomolecular Interaction Analysisfirst appeared onBioradiations.]]>

Investigating Protein Translation with Bio-Rad’s NGC Chromatography System

Bioradiations Staff

The Fraser Laboratory in the Dept. of Molecular and Cellular Biology at UC Davis studies protein translation mechanisms by purifying diverse ribosomal proteins and reconstructing the translation complex in vitro. The lab utilized Bio-Rad’s NGC system to overcome specific purification difficulties with their protein while beta-testing the equipment. The NGC system enabled the group to increase their throughput by 25% and also saved substantial training time.

The postInvestigating Protein Translation with Bio-Rad’s NGC Chromatography Systemfirst appeared onBioradiations.]]>

Amplifying in the Outback: Researcher Brings Real-Time PCR to Australia’s Kimberley Wilderness

Bioradiations Staff

Dr. Tim Inglis of the University of Western Australia seeks better ways to conduct surveillance and respond to outbreaks of tropical infectious diseases. For over a decade he’s been developing detection assays for a slate of pathogens. Find out how Bio-Rad’s MiniOpticon Real-Time PCR system allows him to effectively run these assays in such remote locations as the Kimberley Wilderness in Australia’s Top End.

The postAmplifying in the Outback: Researcher Brings Real-Time PCR to Australia’s Kimberley Wildernessfirst appeared onBioradiations.]]>

Immobilization of Active Kinases for Small Molecule Inhibition Studies

Bioradiations Staff

Surface plasmon resonance (SPR) is a well-established and important screening tool in the small molecule drug discovery workflow. Using the Bio-Rad SPR system ProteOn XPR36, rapid optimization of immobilization conditions for a kinase target was carried out in a fast workflow with a single sensor chip, showing the high performance of the ProteOn XPR36 system.

The postImmobilization of Active Kinases for Small Molecule Inhibition Studiesfirst appeared onBioradiations.]]>

Bio-Rad Science Ambassador Program Pairs Scientists and Schools — Helps Kids Get Into Science

Bioradiations Staff

Following a successful pilot effort in early 2012, Bio-Rad is proud to announce the official launch of the Bio-Rad Science Ambassador Program, which empowers scientists to engage directly with local schools to build student interest in the sciences and increase access to quality science education.

The postBio-Rad Science Ambassador Program Pairs Scientists and Schools — Helps Kids Get Into Sciencefirst appeared onBioradiations.]]>

Gel Doc™ EZ Imaging System — Push-Button Imaging in Just Ten Seconds

Bioradiations Staff

Bio-Rad’s innovative Gel Doc EZ imaging system features something unique that no other imaging system has – brains.

The postGel Doc™ EZ Imaging System — Push-Button Imaging in Just Ten Secondsfirst appeared onBioradiations.]]>

Analyzing Binding Kinetics with Surface Plasmon Resonance Complemented with Direct Mass Spectrometry on the Same Sensor Chip

Bioradiations Staff

Surface Plasmon Resonance (SPR) is an optical phenomenon that is used for the label-free analysis of the binding of any two molecules in real-time.

The postAnalyzing Binding Kinetics with Surface Plasmon Resonance Complemented with Direct Mass Spectrometry on the Same Sensor Chipfirst appeared onBioradiations.]]>

New Premium Hard-Shell Microplate for Applied Biosystems 7500 Fast and ViiA 7 Fast Real-Time PCR systems

Bioradiations Staff

Bio-Rad introduces new Hard-Shell 96-well Semi-skirted low profile PCR plates for optimal performance with a variety of real-time PCR systems.

The postNew Premium Hard-Shell Microplate for Applied Biosystems 7500 Fast and ViiA 7 Fast Real-Time PCR systemsfirst appeared onBioradiations.]]>

New Roche LightCycler 480 Hard-Shell® Plate That Does Not Warp During Thermal Cycling

Bioradiations Staff

Stability during thermal cycling and uniformity of wells are important features in any PCR plate for obtaining reliable results. Bio-Rad’s new Hard-Shell® plates are stable, prevent warping and shrinkage, and are designed for optimal thermal transfer and recovery of samples.

The postNew Roche LightCycler 480 Hard-Shell^®Plate That Does Not Warp During Thermal Cyclingfirst appeared onBioradiations.]]>

ChemiDoc™ MP Imaging System Testimonial — KAIST, South Korea (full version)

Bioradiations Staff

Learn how scientists in the Gene Regulation Laboratory at the Korea Advanced Institute of Science and Technology (KAIST) use the ChemiDoc MP imaging system in their work investigating the molecular machinery involved in epigenetic gene regulation.

The postChemiDoc™ MP Imaging System Testimonial — KAIST, South Korea (full version)first appeared onBioradiations.]]>

Bio-Rad’s New S3™ Cell Sorter Automates and Simplifies Cell Sorting

Bioradiations Staff

Cell sorting is a complex and expensive process, with complicated steps requiring training. Bio-Rad’s new S3™ cell sorter is compact, easy to use, automated, affordable, and provides exceptional sort purity and yield results.

The postBio-Rad’s New S3™ Cell Sorter Automates and Simplifies Cell Sortingfirst appeared onBioradiations.]]>

New CFX96 Touch™ Deep Well Real-Time PCR Instrument Enables Large-Volume qPCR Reactions

Bioradiations Staff

Large sample volumes may sometimes be needed to conduct gene expression studies. Bio-Rad’s new CFX96 Touch Deep Well™ real-time PCR detection system can run sample volumes up to 125 µl and can discriminate up to five targets simultaneously.

The postNew CFX96 Touch™ Deep Well Real-Time PCR Instrument Enables Large-Volume qPCR Reactionsfirst appeared onBioradiations.]]>

CFX Qualification Plate — A Reliable Performance Verification Tool for any CFX Real-Time PCR System

Bioradiations Staff

Verifying the performance of your real-time PCR system is crucial to obtaining reliable data from your experiments. Bio-Rad’s new CFX qualification plate comes with a quick and easy protocol that provides reliable performance verification of any real-time qPCR system.

The postCFX Qualification Plate — A Reliable Performance Verification Tool for any CFX Real-Time PCR Systemfirst appeared onBioradiations.]]>

PrimePCR™ Pathway Analysis: Pathway Curation and Real-Time PCR Panel Design Strategy

Bioradiations Staff

Pathway analysis is an efficient approach for studying a large number of related gene targets in a single experiment. Bio-Rad Laboratories and Thomson Reuters, a leading provider of system biology tools, have partnered to provide predesigned pathway panels for gene expression analyses using real-time qPCR. This tech report describes how Bio-Rad’s PrimePCR™ pathway panels were curated and designed using a ranking strategy developed by Thomson Reuters.

The postPrimePCR™ Pathway Analysis: Pathway Curation and Real-Time PCR Panel Design Strategyfirst appeared onBioradiations.]]>

New Semi-Automated Heat Sealer Delivers Consistent and Reliable PCR Plate Sealing

Bioradiations Staff

The PX1 PCR Plate Sealer efficiently seals microplates used in thermal cycling. This heat sealing method consistently delivers reliable data by helping eliminate sample evaporation during PCR.

The postNew Semi-Automated Heat Sealer Delivers Consistent and Reliable PCR Plate Sealingfirst appeared onBioradiations.]]>

TGX Stain-Free™ Precast Gels Facilitate LDL Research on Potential New Drug Targets

Bioradiations Staff

When Dr. Fred Bauzon started his research, he worked with bioinformatics specialists to functionalize suitable gene candidates based on their expression levels with HMGCR transcript levels. All his experiments demonstrated a reduction in low-density lipoprotein receptor protein (LDLR) and candidate gene protein levels after the candidate gene was silenced. Here Bauzon discusses how TGX Stain-free precast gels have aided his research toward future drug targets for the therapeutic control of LDL uptake.

The postTGX Stain-Free™ Precast Gels Facilitate LDL Research on Potential New Drug Targetsfirst appeared onBioradiations.]]>

ChemiDoc™ MP Imaging System Testimonial — Erlangen, Germany (full version)

Bioradiations Staff

Learn how scientists in the Department of Animal Physiology at the University of Erlangen in Erlangen, Germany use the ChemiDoc MP imaging system in their work investigating sensory systems, in particular, the eye.

The postChemiDoc™ MP Imaging System Testimonial — Erlangen, Germany (full version)first appeared onBioradiations.]]>

New TC20™ Automated Cell Counter Facilitates Quick Counting with Precision

Bioradiations Staff

Bio-Rad’s new TC20 automated cell counter is compatible with broad range of cell sizes and types such as cell lines, primary cells (from tissue or blood), and stem cells.

The postNew TC20™ Automated Cell Counter Facilitates Quick Counting with Precisionfirst appeared onBioradiations.]]>

Expect More From Your Chemiluminescent Substrate: Introducing Clarity™ Western ECL Substrate

Bioradiations Staff

Bio-Rad’s new Clarity Western ECL substrate provides high sensitivity, long signal duration, and low background even at long exposures.

The postExpect More From Your Chemiluminescent Substrate: Introducing Clarity™ Western ECL Substratefirst appeared onBioradiations.]]>

Trans-Blot® Turbo™ Ready-to-Assemble (RTA) Kit Enables Economical, Rapid, and Efficient Western Blot Transfers

Bioradiations Staff

Bio-Rad’s latest semi-dry transfer system, the Trans-Blot® Turbo™, has changed the way researchers think about western blot transfers.

The postTrans-Blot^®Turbo™ Ready-to-Assemble (RTA) Kit Enables Economical, Rapid, and Efficient Western Blot Transfersfirst appeared onBioradiations.]]>

PrimePCR™ Assays: Meeting the MIQE Guidelines by Full Wet-Lab Validation

Bioradiations Staff

The MIQE guidelines have set a new standard for publishing qPCR results to ensure integrity in the scientific literature and increase experimental transparency. One of the key guidelines focuses on the proper design and experimental validation of primer assays used in qPCR. This tech report describes the design and wet-lab validation of PrimePCR assays and how they comply with the MIQE guidelines.

The postPrimePCR™ Assays: Meeting the MIQE Guidelines by Full Wet-Lab Validationfirst appeared onBioradiations.]]>

High Sensitivity of Bio-Plex® Multiplex System is Key in Study for Novel Melanoma Therapeutics

Bioradiations Staff

alt

Melanoma is an aggressive cancer where early detection is essential for patient survival. The Facchiano lab is developing new anti-proliferation molecules against melanoma and is working to identify new molecular markers at the very early stages of pathology. Here Dr Antonio Facchiano discusses the merits of using the Bio-Plex technology to measure dose-dependent changes in expression levels of growth and angiogenic factors in cell lysates and supernatants.

The postHigh Sensitivity of Bio-Plex^®Multiplex System is Key in Study for Novel Melanoma Therapeuticsfirst appeared onBioradiations.]]>

Bio-Plex® Multiplex System is Key in Novel Melanoma Therapeutics Study

Bioradiations Staff

Researchers at the Immaculate Dermopathic Institute (IDI-IRCCS, Rome) are using Bio-Plex technology in developing new anti-proliferation molecules and markers at the early stages of melanoma pathology. Dr Antonio Facchiano discusses how Bio-Plex has expedited the lab’s research.

The postBio-Plex^®Multiplex System is Key in Novel Melanoma Therapeutics Studyfirst appeared onBioradiations.]]>

New and Improved CFX Manager™ Software for Real-Time PCR Data Acquisition and Analysis

Bioradiations Staff

The latest version of the CFX Manager software provides a variety of usability enhancements and powerful new data analyses so users can get the most out of each run.

The postNew and Improved CFX Manager™ Software for Real-Time PCR Data Acquisition and Analysisfirst appeared onBioradiations.]]>

PDQuest™ Software: Bite-Sized Video Tutorials Make Learning 2-D Analysis Easy

Bioradiations Staff

Learning to use analysis software can be time-consuming and following a manual can be challenging.

The postPDQuest™ Software: Bite-Sized Video Tutorials Make Learning 2-D Analysis Easyfirst appeared onBioradiations.]]>

PDQuest™ Software Tutorials

Bioradiations Staff

The nine PDQuest tutorials are chapterized so you can focus on what you want to learn. Each video runs from 3 to 9 minutes and features callout boxes that highlight important information to complement the audio explanations.

The postPDQuest™ Software Tutorialsfirst appeared onBioradiations.]]>

QX100™ Droplet Digital™ ddPCR™ System at Sangamo BioSciences

Bioradiations Staff

Researchers at Sangamo BioSciences, Inc. explain the benefits of using third generation PCR as it applies to their research in the field of personalized medicine. Watch to see the latest generation of quantitative PCR in action.

The postQX100™ Droplet Digital™ ddPCR™ System at Sangamo BioSciencesfirst appeared onBioradiations.]]>

New Gradient Format Mini-PROTEAN® TGX Stain-Free™ Precast Gels for SDS-PAGE — Streamlining Electrophoresis and Blotting Workflows

Bioradiations Staff

Mini-PROTEAN® TGX Stain-Free™ precast gels are now available in gradient format. This unique gel formation allows for fast gel electrophoresis and blotting, and does not require staining and destaining for imaging.

The postNew Gradient Format Mini-PROTEAN^®TGX Stain-Free™ Precast Gels for SDS-PAGE — Streamlining Electrophoresis and Blotting Workflowsfirst appeared onBioradiations.]]>

Experimentally Validated PrimePCR™ Assays and Panels for Real-Time PCR

Bioradiations Staff

PrimePCR™ assays set a new standard for real-time PCR. Bio-Rad® collaborated with the leaders in real-time PCR to design, optimize, and experimentally validate every primer pair.

The postExperimentally Validated PrimePCR™ Assays and Panels for Real-Time PCRfirst appeared onBioradiations.]]>

Droplet Digital PCR Opens New Perspectives in HIV Research

Bioradiations Staff

Sangamo BioSciences, Inc., located in Richmond, California, is developing HIV therapeutics toward a functional cure using their proprietary zinc finger DNA-binding protein technology. Droplet digital PCR (ddPCR™) — or third generation PCR — offers a superior solution as it can detect target sequence within a single molecule, making it a powerful technology for low copy event detection.

The postDroplet Digital PCR Opens New Perspectives in HIV Researchfirst appeared onBioradiations.]]>

Image Lab™ 4.1, the Latest Software Version, Addresses the Challenges of Multiplex Analysis and Protein Normalization

Bioradiations Staff

The updated Image Lab image acquisition and analysis software provides improved tools for total protein normalization using the stain-free technology.

The postImage Lab™ 4.1, the Latest Software Version, Addresses the Challenges of Multiplex Analysis and Protein Normalizationfirst appeared onBioradiations.]]>

Bio-Rad’s New 4x Laemmli Sample Buffer for SDS-PAGE

Bioradiations Staff

Detecting dilute protein samples using standard protein gel stains can be problematic. One method of enabling increased sample capacity on gels is to increase the well size. The newly introduced 4x Laemmli sample buffer improves sample loading capacity, improving the detection of low-abundance proteins.

The postBio-Rad’s New 4x Laemmli Sample Buffer for SDS-PAGEfirst appeared onBioradiations.]]>

Video Tutorial for Analyzing Binding Interactions with Histidine-Tagged Proteins

Bioradiations Staff

Analyzing antibody binding to histidine-tagged proteins is not always easy because of inherent problems such as nonspecific binding and loss of analyte response associated with these tagged proteins. Optimization of these factors is key to precisely measuring the binding kinetics of these proteins.

The postVideo Tutorial for Analyzing Binding Interactions with Histidine-Tagged Proteinsfirst appeared onBioradiations.]]>

V3 Western Workflow™

Bioradiations Staff

Bio-Rad’s five-step western blotting workflow incorporates traditional blotting techniques with innovative technology, allowing quick confirmation of gel runs and blot transfers, and simplifying protein normalization. See how it works.

The postV3 Western Workflow™first appeared onBioradiations.]]>

Novel V3 Western Workflow™ Revolutionizes Protein Research

Bioradiations Staff

Although the Western blot is a core lab procedure, surprisingly little has changed in traditional bench work practice since its inception in 1979. The V3 Western Workflow delivers a streamlined solution to the conventional western blotting workflow as explored here by one protein researcher specializing in chronic obstructive pulmonary disease (COPD).

The postNovel V3 Western Workflow™ Revolutionizes Protein Researchfirst appeared onBioradiations.]]>

Focus on the Biology: Bio-Rad’s New Bio-Plex Data Pro™ Software Simplifies Multiplex Data Analysis

Bioradiations Staff

Many instruments offer multiplexing capability for biomarker measurements. But to handle and make sense of the huge amount of multiplex data requires sophisticated software like Bio-Plex Data Pro, which simplifies organization, import, sorting and visualization of data, and performing calculations and statistical analyses.

The postFocus on the Biology: Bio-Rad’s New Bio-Plex Data Pro™ Software Simplifies Multiplex Data Analysisfirst appeared onBioradiations.]]>

Multiplex Analysis of Inflammatory Markers Using Bio-Plex Pro™ Human Th17 Cytokine Assays

Bioradiations Staff

The T-helper cell (Th17) pathway has been implicated in several autoimmune diseases and in cancer. New magnetic bead–based assays have been developed for several biomarkers in this pathway. The performance characteristics of these assays are evaluated from data on intra- and inter-assay precision, standard curve recovery, cross reactivity, and linearity of dilution.

The postMultiplex Analysis of Inflammatory Markers Using Bio-Plex Pro™ Human Th17 Cytokine Assaysfirst appeared onBioradiations.]]>

The QX100™ Droplet Digital™ PCR System Workflow

Bioradiations Staff

Watch the step-by-step workflow for absolute quantification of DNA molecules using the third generation droplet digital PCR technology.

The postThe QX100™ Droplet Digital™ PCR System Workflowfirst appeared onBioradiations.]]>

Novel HRM Assays Expedite Drug Resistance Surveillance for Leprosy Research

Bioradiations Staff

The significant drop in leprosy worldwide is attributed to the development of antimicrobial multidrug therapy (MDT). Resistance to rifampicin — the backbone of MDT treatment — has appeared. Controlling leprosy transmission requires routine surveillance for mutations in the drug target genes before, during, and after the course of treatment. New high resolution melt (HRM) assays offer leprosy researchers a faster, more economical method to investigate resistance targets.

The postNovel HRM Assays Expedite Drug Resistance Surveillance for Leprosy Researchfirst appeared onBioradiations.]]>

Campus Source Reduction Programs Bolster Environmental Savings: Sustainability Part Three

Bioradiations Staff

Practicing source reduction — simply creating less waste — helps industries decrease raw material use. Despite improvements in global recycling since the first Earth Day on April 22, 1970, the amount of generated waste has increased substantially. Bio-Rad recognizes that source reduction is essential for conserving natural resources. Highlighted here are several source reduction projects from the Bio-Rad campus in recognition of Earth Day 2012 that complement our mission to provide high-quality products to advance scientific discovery globally.

The postCampus Source Reduction Programs Bolster Environmental Savings: Sustainability Part Threefirst appeared onBioradiations.]]>

A Simple Method for Obtaining Absolute Quantification of DNA Molecules Using the Innovative Droplet Digital™ PCR Technology

Bioradiations Staff

Droplet digital PCR is considered the third generation of PCR technology. This technology enables the quantification of absolute measure of target DNA molecules, rather than the relative measure obtained from real-time PCR. Absolute quantification is advantageous in several applications, such as measuring copy number variation, detecting rare sequences and mutations, and analyzing gene expression.

The postA Simple Method for Obtaining Absolute Quantification of DNA Molecules Using the Innovative Droplet Digital™ PCR Technologyfirst appeared onBioradiations.]]>

Bio-Plex® System in Korea

Bioradiations Staff

Dr Hunseok Lee of Seoul National University explains why it was advantageous for him to use the Bio-Plex system to measure cytokine levels in patients administered with the new cancer vaccine that his laboratory has developed.

The postBio-Plex^®System in Koreafirst appeared onBioradiations.]]>

Solar Power Shines as a Bright Alternative to Fossil Fuel: Sustainability Part Two

Bioradiations Staff

California, with its abundance of sunshine, has a long history of support for solar energy. For Bio-Rad — headquartered in Hercules, California — solar power made business and environmental sense when considering clean energy alternatives. Bio-Rad’s solar project has proved to be a step in the right direction, mitigating the environmental impact of the company’s energy use, now and in the years to come.

The postSolar Power Shines as a Bright Alternative to Fossil Fuel: Sustainability Part Twofirst appeared onBioradiations.]]>

Green Thinking Sparks New Ideas, Better Programs: Sustainability Part One

Bioradiations Staff

Bio-Rad recognizes that reducing shipping associated with consumer products is a direct opportunity to slow greenhouse gas emissions contributing to climate change. Bio-Rad supply centers consolidate shipping and packaging. Small steps collectively lead to big change. This is the first installation in a three-part series on sustainable practices developed on the Bio-Rad campus.

The postGreen Thinking Sparks New Ideas, Better Programs: Sustainability Part Onefirst appeared onBioradiations.]]>

Bio-Plex® System in Korea — Seeking to Improve Outcomes for Cancer Patients

Bioradiations Staff

Dr Hunseok Lee has known since childhood that he wanted to grow up to become a scientist. “You get to wear white gowns, look through a microscope at various substances so small they can’t be seen by the naked eye — those things were very attractive to me when I was young,” says Lee. But the realities of putting research into practice and translating ideas into experiments have proven far more strenuous than the young Lee anticipated.

The postBio-Plex^®System in Korea — Seeking to Improve Outcomes for Cancer Patientsfirst appeared onBioradiations.]]>

New Multiplex Assays for Th17 Cytokine Research

Bioradiations Staff

The Bio-Plex Pro human Th17 cytokine panel is a unique blend of magnetic bead-based multiplex immunoassays for the robust and reproducible measurement of 15+1 soluble proteins involved in the T-helper cell type 17 immune response pathway.

The postNew Multiplex Assays for Th17 Cytokine Researchfirst appeared onBioradiations.]]>

Mini-PROTEAN® TGX™ Gels — Customer Testimonials

Bioradiations Staff

Scientists from UCSD, UCD, The Salk Institute, and the University of Alabama talk about the speed, performance, and quality of electrophoresis runs using the Mini-PROTEAN TGX gels in their labs.

The postMini-PROTEAN^®TGX™ Gels — Customer Testimonialsfirst appeared onBioradiations.]]>

PrimePCR™ Lookup Tool

Bioradiations Staff

Use the PrimePCR lookup tool to find assays and panels for your genes of interest.

The postPrimePCR™ Lookup Toolfirst appeared onBioradiations.]]>

A New Paradigm for Precise Quantitation of RNA

Bioradiations Staff

The one-step RT-ddPCR kit for probes creates a new paradigm for the precise quantitation of RNA by combining reverse transcription with Droplet Digital™ PCR (ddPCR™), providing an absolute measure of target RNA molecules with unrivaled precision and sensitivity

The postA New Paradigm for Precise Quantitation of RNAfirst appeared onBioradiations.]]>

Introducing iTaq Universal Supermixes for Highest Quality qPCR Results on Any Instrument

Bioradiations Staff

The iTaq™ universal SYBR®Green supermix and iTaq™ universal probes supermix are ready-to-use 2x supermixes formulated for sensitive, efficient, and reproducible qPCR data on any instrument.

The postIntroducing iTaq Universal Supermixes for Highest Quality qPCR Results on Any Instrumentfirst appeared onBioradiations.]]>

在两路自动支撑中心操作

Bioradiations Staff

Automated supply centers reduce paper and packaging waste，apart from providing convenience.As part of its sustainability efforts，Bio-Rad is increasing the number of its supply center sites.The video describes how the supply center works。

The post在两路自动支撑中心操作first appeared onBioradiations.]]>

Third Generation PCR

Bioradiations Staff

The McCarroll laboratory studies the biological effects of human genome polymorphism, seeking to define how genome variation influences gene expression and risk of disease.

The postThird Generation PCRfirst appeared onBioradiations.]]>

Around the World with the ChemiDoc™ MP Imaging System

Bioradiations Staff

Bio-Rad has long demonstrated innovation in imaging, with the introduction of the stain-free gel electrophoresis workflow, which was rapidly followed by the launch of the Gel Doc™ EZ imager. Now, this progression continues with the release of the ChemiDoc™ MP imaging system.

The postAround the World with the ChemiDoc™ MP Imaging Systemfirst appeared onBioradiations.]]>

Application of Hexapeptide Libraries for Enhanced Protein Detection in Human Cellular Lysates

Bioradiations Staff

Hexapeptide libraries, such as Bio-Rad's ProteoMiner™ protein enrichment technology, can significantly increase sensitivity of shotgun proteomics analyses of diverse complex samples. Underlying this increased sensitivity is the partial removal of high-abundance proteins leading to an increased representation of low-abundance proteins — a phenomenon described as dynamic range compression. Currently, hexapeptide libraries have been mostly used to increase proteomic detection in fluid samples (eg: saliva, plasma, etc.), but not in cellular lysates.

The postApplication of Hexapeptide Libraries for Enhanced Protein Detection in Human Cellular Lysatesfirst appeared onBioradiations.]]>

Transitioning from Chemiluminescent to Multiplex Fluorescent Blotting: Things to Consider

Bioradiations Staff

Today many researchers are considering changing their western blot detection method from chemiluminescence to multiplex fluorescence. There are several drivers behind this trend. Most significantly, fluorescent detection allows users to multiplex their western blots, enabling simultaneous detection of several target proteins at once, reducing or eliminating the need to strip and re-probe. Other benefits of fluorescence include better dynamic range, more quantitative results, and better signal stability over time.

The postTransitioning from Chemiluminescent to Multiplex Fluorescent Blotting: Things to Considerfirst appeared onBioradiations.]]>

Highly Efficient Lipoparticle Capture and SPR Binding Kinetics of a Membrane Protein Using the ProteOn™ XPR36 Protein Interaction Array System

Bioradiations Staff

The genes coding for membrane proteins, such as G-protein coupled receptors (GPCR), ion channels, and other membrane-bound enzymes make up 25–30% of the human genome and membrane proteins are estimated to represent 30–40% of the top drug targets. There is growing research, industrial, and commercial interest in the study of membrane proteins in general, and more specifically in immobilizing membrane proteins to various biosensor surfaces.

The postHighly Efficient Lipoparticle Capture and SPR Binding Kinetics of a Membrane Protein Using the ProteOn™ XPR36 Protein Interaction Array Systemfirst appeared onBioradiations.]]>

A MIQE Case Study — Effect of RNA Sample Quality and Reference Gene Stability on Gene Expression Data

Bioradiations Staff

This tech report shows how qPCR can lead to erroneous conclusions regarding differences in MCM7 gene expression between normal and tumor human breast cancer samples if the key steps set out in the MIQE guidelines are not followed.

The postA MIQE Case Study — Effect of RNA Sample Quality and Reference Gene Stability on Gene Expression Datafirst appeared onBioradiations.]]>

PROTEAN® i12™ IEF System Introduction

Bioradiations Staff

Bio-Rad’s PROTEAN i12 IEF system is specially designed for running different sample types, different gradients, and multiple 2-D electrophoresis protocols at the same time. Watch the video to learn about all the new features of this IEF system.

The postPROTEAN^®i12™ IEF System Introductionfirst appeared onBioradiations.]]>

QX100™ Droplet Digital™ PCR system

Bioradiations Staff

Bio-Rad’s QX100™ Droplet Digital™ PCR system provides an absolute measure of target DNA molecules with unrivaled precision and accuracy.

The postQX100™ Droplet Digital™ PCR systemfirst appeared onBioradiations.]]>

Bio-Rad Introduces New Bio-Plex® Human Cancer Assays

Bioradiations Staff

Bio-Plex Pro™ Human Cancer Biomarker Panel 1 is a unique blend of magnetic bead-based assays designed to meet the needs of the most discerning preclinical and clinical researchers.

The postBio-Rad Introduces New Bio-Plex^®Human Cancer Assaysfirst appeared onBioradiations.]]>

Using the new PROTEAN® i12™ IEF System to Achieve Highly Reproducible Data and Extended Separation Over Multiple pH Ranges in a Single Run

Bioradiations Staff

2-D electrophoresis is a multistep technique that separates proteins first by a protein’s isoelectric point and then by its molecular weight. This powerful technique can separate thousands of proteins in a complex proteome and is useful for applications such as protein profiling and biomarker discovery. The drawback of the technique is that it requires multiple steps, each of which can be time-consuming and can contribute to problems with reproducibility.

The postUsing the new PROTEAN^®i12™ IEF System to Achieve Highly Reproducible Data and Extended Separation Over Multiple pH Ranges in a Single Runfirst appeared onBioradiations.]]>

Use of the PROTEAN® i12™ IEF System for In-Gel Peptide Fractionation Prior to LC-MS and Comparison with Off-Gel Fractionation

Bioradiations Staff

This tech report compares in-gel and off-gel separation of proteins in terms of overall speed and simplicity of the workflow, resolution of the separation, and depth of proteome coverage provided. Results found that as well as higher peptide yields, in-gel separations were better suited to take full advantage of downstream analysis methods.

The postUse of the PROTEAN^®i12™ IEF System for In-Gel Peptide Fractionation Prior to LC-MS and Comparison with Off-Gel Fractionationfirst appeared onBioradiations.]]>

TGX Stain-Free™ Precast Gels

Bioradiations Staff

Mini-PROTEAN® TGX Stain-Free™ and Criterion™ TGX Stain-Free™ precast gels, when combined with Bio-Rad's ChemiDoc™ MP or Gel Doc™ EZ imagers, provide researchers with the fastest protein separation and visualization available using the standard Laemmli system.

The postTGX Stain-Free™ Precast Gelsfirst appeared onBioradiations.]]>

Protein Expression and Purification Series — A Laboratory Course for Training Researchers

Bioradiations Staff

Protein Expression and Purification Laboratory Course for Training Researchers on Protein Expression and Purification.

The postProtein Expression and Purification Series — A Laboratory Course for Training Researchersfirst appeared onBioradiations.]]>

ProteOn™ HTE Sensor Chip

Bioradiations Staff

The HTE sensor chip is designed for label-free biomolecular interaction analysis with polyhistidine-tagged proteins. It features a novel tris-NTA (3-NTA) surface for excellent performance of polyhistidine-tagged protein capture, providing high binding stability and regeneracy. It is an ideal choice for the applications of protein-small molecule and other protein interactions requiring high sensitivity.

The postProteOn™ HTE Sensor Chipfirst appeared onBioradiations.]]>

Stellan Hjertén Wins the California Separations Science Society Award

Bioradiations Staff

This year the California Separation Science Society will present its annual Scientific Achievement Award to Professor Stellan Hjertén of Uppsala University. The award dinner will be held November 3, 2011 at the Waterfront Hotel in Jack London Square.

The postStellan Hjertén Wins the California Separations Science Society Awardfirst appeared onBioradiations.]]>

One Array, 36 Unique Protein Interactions

Bioradiations Staff

The ProteOn XPR36 protein interaction analysis system was introduced in 2006 to provide a novel array technology to researchers conducting label-free analysis of proteins. The ProteOn system is a high-throughput surface plasmon resonance-based screening tool for a wide range of applications from small-molecule drug discovery to antibody kinetic ranking, epitope binning, and epitope mapping.

The postOne Array, 36 Unique Protein Interactionsfirst appeared onBioradiations.]]>

ChemiDoc™ MP Imaging System

Bioradiations Staff

The ChemiDoc MP imaging system enables stain-free operation and lets you visualize proteins at every stage of your experiment. Its flexibility and sensitivity are complemented by a simple, intuitive operation that integrates seamlessly into your workflow.

The postChemiDoc™ MP Imaging Systemfirst appeared onBioradiations.]]>

PROTEAN® i12™ IEF System

Bioradiations Staff

Introducing Bio-Rad's PROTEAN i12 IEF system. Each channel in the i12™ focusing tray is powered by its own power supply, enabling precise control over each IPG strip. This makes it possible to run different sample types, different gradients, and multiple protocols all at the same time.

The postPROTEAN^®i12™ IEF Systemfirst appeared onBioradiations.]]>

PROTEAN® i12™ IEF System: Independent Voltage and Current Control Enables Optimization of First-Dimension IEF Conditions

Bioradiations Staff

This tech report demonstrates the advantages of independently controlled voltage and current parameters for each focusing tray in optimizing IEF conditions for a complex, insoluble membrane protein fraction.

The postPROTEAN^®i12™ IEF System: Independent Voltage and Current Control Enables Optimization of First-Dimension IEF Conditionsfirst appeared onBioradiations.]]>

Immun-Blot® LF (Low Fluorescence) PVDF Membranes

Bioradiations Staff

Immun-Blot LF (low fluorescence) PVDF membranes are protein blotting membranes optimized for fluorescent and multiplex fluorescent applications. They offer high signal-to-background ratio, low autofluorescence, and superior protein retention to maximize blot detection sensitivity and enable downstream quantitation.

The postImmun-Blot^®LF (Low Fluorescence) PVDF Membranesfirst appeared onBioradiations.]]>

Accurate Counting of Bio-Plex® Magnetic or Polystyrene Beads Using the TC10™ Automated Cell Counter

Bioradiations Staff

This report demonstrates that the TC10 automated cell counter is a suitable alternative to the Coulter Counter and hemocytometer for the preparation of custom Bio-Plex assays.

The postAccurate Counting of Bio-Plex^®Magnetic or Polystyrene Beads Using the TC10™ Automated Cell Counterfirst appeared onBioradiations.]]>

Bio-Plex® System Bench to Bedside

Bioradiations Staff

Watch how the Bio-Plex® suspension array system has contributed to research findings in Dr Francis Spinale and Dr Steven Kornblau's laboratories that have the potential to impact screening and treatment of disease.

The postBio-Plex^®System Bench to Bedsidefirst appeared onBioradiations.]]>

Gel Doc™ EZ Imaging System Customer Testimonial

Bioradiations Staff

Harvard Medical School Postdoctoral student Sririam Kosuri explains how the Gel Doc EZ system has changed the way researchers image gels in the George Church lab at Harvard Medical School’s Wyss Institute.

The postGel Doc™ EZ Imaging System Customer Testimonialfirst appeared onBioradiations.]]>

Gel Doc™ EZ Testimonial — UCSD

Bioradiations Staff

Assistant Project Scientist Dr. Dorota Krawczyk, PhD, at the Geoff Rosenfeld Laboratory at the University of California, San Diego, describes how easy it is to use the Gel Doc EZ system.

The postGel Doc™ EZ Testimonial — UCSDfirst appeared onBioradiations.]]>

Innovating Electrophoresis with Precast Gels

Bioradiations Staff

Setting new standards for consistency and speed in the electrophoresis workflow.

The postInnovating Electrophoresis with Precast Gelsfirst appeared onBioradiations.]]>

Trans-Blot Turbo Instructional Video

Bioradiations Staff

Instructional video to guide you through the features, benefits, and operation of the Trans-Blot Turbo system.

The postTrans-Blot Turbo Instructional Videofirst appeared onBioradiations.]]>

Trans-Blot® Turbo™ System vs. the iBlot System

Bioradiations Staff

Battle of the blotters: see how the Trans-Blot Turbo system performs compared to the iBlot dry blotting system.

The postTrans-Blot^®Turbo™ System vs. the iBlot Systemfirst appeared onBioradiations.]]>

Trans-Blot® Turbo™ System vs. Traditional Blotting Techniques

Bioradiations Staff

See how the Trans-Blot Turbo system measures up against traditional blotting techniques.

The postTrans-Blot^®Turbo™ System vs. Traditional Blotting Techniquesfirst appeared onBioradiations.]]>

Identifying Cardiac Defect–Related Protein Signatures

Bioradiations Staff

Identifying Cardiac Defect–Related Protein SignaturesAugust 15, 2011
"The first opportunity I had to lay my hand on a human heart I knew that was that — I knew that I wanted to know how the heart works, but more importantly, how it doesn't work," says Dr Francis Spinale, describing his inspiration to both research and treat cardiac disease. Using the Bio-Plex® suspension array system, researchers in his laboratory are discovering protein signatures that have the potential to inform decision strategies in cardiac patient treatment.

The postIdentifying Cardiac Defect–Related Protein Signaturesfirst appeared onBioradiations.]]>

Chemokines and Cytokines as Potential Markers for Personalizing Leukemia Treatment

Bioradiations Staff

Dr. Steven Kornblau has been on faculty at MD Anderson Cancer Center in Houston, Texas, for 20 years, where he divides his time between research into further understanding leukemia disease states, and a clinical practice where he treats a small number of patients with the disease. Recently, his laboratory used the Bio-Plex®suspension array system to discover how cytokine and chemokine profiles alone can be prognostic for patients with the disease, and therefore have to potential to assist development of personalized treatments.

The postChemokines and Cytokines as Potential Markers for Personalizing Leukemia Treatmentfirst appeared onBioradiations.]]>

High-Throughput Automated Extraction of RNA Using the Aurum™ Total RNA 96 Kit

Bioradiations Staff

This tech report describes an automated method of RNA extraction using the Aurum total RNA 96 kit and its use in a magnetic–bead based automated process. Results show that throughput can be easily increased with the Aurum total RNA 96 kit and that the automation protocols yield more reliable results, particularly when high sample volumes are used.

The postHigh-Throughput Automated Extraction of RNA Using the Aurum™ Total RNA 96 Kitfirst appeared onBioradiations.]]>

C-96 Autosampler for Reliable Protein Purification Sample Application

Bioradiations Staff

The C-96 autosampler improves the efficiency of protein purification workflows by enabling automated sample application. The straightforward tray designs are easy to use; the standard tray accommodates 84 sample vials (5 ml each) plus three additional vials (10 ml each) for mixing and dilution protocols.

The postC-96 Autosampler for Reliable Protein Purification Sample Applicationfirst appeared onBioradiations.]]>

Targeting Suppression of B-Cell Lymphoma Proliferation

Bioradiations Staff

Rossi considers the discovery of RNAi as pivotal to antiviral discovery. "RNAi has become another important, powerful genetic tool we can use to further our antiviral work," he says. Rossi's lab became the first to publish research demonstrating the expression of small interfering RNAs (siRNAs) to inhibit HIV replication in human cells. Various aspects of RNAi and siRNAs continue to play a key role in his research on viral diseases and lymphomas.

The postTargeting Suppression of B-Cell Lymphoma Proliferationfirst appeared onBioradiations.]]>

Hard-Shell® 384-Well 480 PCR Plates

Bioradiations Staff

The proprietary warp-free Hard-Shell plates have a reputation as premium plates and were widely used on Bio-Rad, MJ, and Applied Biosystems instruments for the Human Genome Project. Now, researchers can use the same high-quality Hard-Shell plates on Roche LightCycler 480 instruments.

The postHard-Shell^®384-Well 480 PCR Platesfirst appeared onBioradiations.]]>

Using Precision Plus Protein™ WesternC™ Standards to Validate Major Steps in the Western Blotting Workflow

Bioradiations Staff

Western blotting, although a commonly used technique, involves a time-consuming multi step process. The whole western blotting workflow could take up to three days to complete. Thus, having a tool to monitor each of the major steps in the western blotting workflow reduces chances of finding out at the very end of the workflow that an experiment was not successful.

The postUsing Precision Plus Protein™ WesternC™ Standards to Validate Major Steps in the Western Blotting Workflowfirst appeared onBioradiations.]]>

Bio-Plex® Assay Configurations Simplified with the Bio-Plex Assay Builder for Complete Flexibility

Bioradiations Staff

Now you can optimize research expenditure by multiplexing only the targets you need to get the answers you're seeking. This newly updated tool allows you to choose from within panels to build the perfect kit.

The postBio-Plex^®Assay Configurations Simplified with the Bio-Plex Assay Builder for Complete Flexibilityfirst appeared onBioradiations.]]>

Gel Doc™ EZ Imaging System – A Tale of Speed and Simplicity in Two Cities

Bioradiations Staff

The Gel Doc™ EZ imaging system makes an impact from coast to coast — at the Wyss Institute for Biologically Inspired Engineering at Harvard University in Boston, and in the Geoff Rosenfeld Laboratory at the University of California, San Diego.

The postGel Doc™ EZ Imaging System – A Tale of Speed and Simplicity in Two Citiesfirst appeared onBioradiations.]]>

Simplicity in Imaging: From Conception to Launch

Bioradiations Staff

When it comes to gel imaging and blotting, conventional imaging devices have tended to offer either high-performance, complex functionality or low-cost, low-performance simplicity. That is, until now.

The postSimplicity in Imaging: From Conception to Launchfirst appeared onBioradiations.]]>

Guidelines for Developing Robust and Reproducible High-Resolution Melt Analysis Assays

Bioradiations Staff

Classifying and understanding genetic variation between populations and individuals is an important aim in the field of genomics. High resolution melt (HRM) analysis is the quantitative analysis of the melt curve of a DNA fragment following amplification by PCR and can be considered the next-generation application of amplicon melting analysis. Careful sample preparation and planning of experimental and assay design are crucial for robust and reproducible results.

The postGuidelines for Developing Robust and Reproducible High-Resolution Melt Analysis Assaysfirst appeared onBioradiations.]]>

Efficient Electrophoresis: Aiding Advances in Cardiomiopathy Research

Bioradiations Staff

The electrophoretic workflow has undergone few changes since it was solidified as a fundamental tool in life science research in the 1970s. Today, just like then, researchers need to prepare samples, load gels, then perform separation and further downstream analysis, including western blotting.

The postEfficient Electrophoresis: Aiding Advances in Cardiomiopathy Researchfirst appeared onBioradiations.]]>

Unlocking the Potential of Stem Cell Research Using the EpiQ™ Chromatin Analysis Kit

Bioradiations Staff

Bedtime stories in Dr David Schaffer's — one of today's pioneers in stem cell research — childhood home were often not standard fairy tales. With both parents in careers as biomedical researchers (his mother in drug development and clinical trials for a major pharmaceutical company and his father, in cardiovascular research and a pharmacology professor) much of the conversation as far back as Schaffer can remember centered on biology and science.

The postUnlocking the Potential of Stem Cell Research Using the EpiQ™ Chromatin Analysis Kitfirst appeared onBioradiations.]]>

Protein Quantitation Assays — Frequently Asked Questions

Bioradiations Staff

Protein quantitation is an important part of many workflows. The estimation or quantitation of the protein in a sample frequently allows researchers to understand the results from their work and make decisions on the subsequent steps. Presented are answers to some of the most frequently ask questions related to usage of Bio-Rad's colorimetric assays for protein quantitation.

The postProtein Quantitation Assays — Frequently Asked Questionsfirst appeared onBioradiations.]]>

Using the Precision Plus Protein™ WesternC™ Standard as a QC Tool at Key Steps in Your Electrophoresis and Blotting Workflow

Bioradiations Staff

As a fundamental tool in protein research, it is critical that all steps of the electrophoresis workflow (from running gels to visualizing blots) are performed successfully to ensure accurate, reliable, and reproducible results. Protein standards are often used to monitor electrophoretic separation and transfer efficiency but do not always enable ladder visualization after blot development.

The postUsing the Precision Plus Protein™ WesternC™ Standard as a QC Tool at Key Steps in Your Electrophoresis and Blotting Workflowfirst appeared onBioradiations.]]>

ProteOn™ XPR36 Protein Interaction Array System

Bioradiations Staff

An overview of how the ProteOn XPR36 protein interaction array system can benefit your surface-plasmon reasonance-based research.

The postProteOn™ XPR36 Protein Interaction Array Systemfirst appeared onBioradiations.]]>

Nuvia™ S Media — A High-Capacity Cation Exchanger for Biomolecule Purification and Downstream Processing

Bioradiations Staff

Nuvia S media is a high-capacity strong cation exchanger (CEX) developed to operate over a range of experimental conditions, allowing scientists to scale up from laboratory- to process-scale more quickly and easily. Our data demonstrate that the high capacity and superb purification of Nuvia S media can significantly improve productivity by offering the robustness, capacity, and speed for processing large load volumes with smaller columns and less buffer consumption.

The postNuvia™ S Media — A High-Capacity Cation Exchanger for Biomolecule Purification and Downstream Processingfirst appeared onBioradiations.]]>

All cDNA Synthesis Kits Are Not Created Equal: RNase A Inhibition and Its Effect on qPCR Data

Bioradiations Staff

Not all cDNA synthesis kits have the same capacity to protect the integrity of RNA. An optimal level of RNase inhibitor is critical for powerful RNase inhibition and efficient reverse transcription. The iScript™ cDNA synthesis kit comes with a 5x iScript reaction mix and iScript reverse transcriptase, which is also blended with a potent RNase inhibitor.

The postAll cDNA Synthesis Kits Are Not Created Equal: RNase A Inhibition and Its Effect on qPCR Datafirst appeared onBioradiations.]]>

Comparison between the TC10™ Automated Cell Counter and the Lactate Dehydrogenase (LDH) Assay to Assess Cellular Toxicity in vitro

Bioradiations Staff

This tech report presents the results of a comparative study between the TC10 automated cell counter and the classical LDH assay to measure cell viability in suspension cells. Results show that the TC10 cell counter can replace the LDH assay to measure both the viability of cell suspensions and the cytotoxic effects of various compounds.

The postComparison between the TC10™ Automated Cell Counter and the Lactate Dehydrogenase (LDH) Assay to Assess Cellular Toxicity in vitrofirst appeared onBioradiations.]]>

Using the TC10™ Automated Cell Counter

Bioradiations Staff

A better, more accurate, easier way to count cells than a traditional hemocytometer — learn how this automated system works.

The postUsing the TC10™ Automated Cell Counterfirst appeared onBioradiations.]]>

Bio-Plex Pro™ Mouse Th17 Cytokines

Bioradiations Staff

Bio-Plex Pro™ mouse Th17 assays are magnetic bead–based multiplex assays that offer accurate and reproducible measurements of 20 target molecules in serum, plasma, and tissue culture sample types for mouse models. These assays have been developed to provide reliable performance with the flexibility required to meet all of your research needs.

The postBio-Plex Pro™ Mouse Th17 Cytokinesfirst appeared onBioradiations.]]>

Research Applications for the EpiQ™ Chromatin Analysis Kit

Bioradiations Staff

EpiQ chromatin analysis kit is a novel epigenetics research tool for the quantitative assessment of chromatin structure in cultured cells. By combining in situ chromatin digestion, genomic DNA purification, and real-time PCR, the chromatin state for several gene promoters can be studied simultaneously.

The postResearch Applications for the EpiQ™ Chromatin Analysis Kitfirst appeared onBioradiations.]]>

The T100™ Thermal Cycler

Bioradiations Staff

Why the T100 thermal cycler is the smart choice for your PCR.

The postThe T100™ Thermal Cyclerfirst appeared onBioradiations.]]>

Trans-Blot® Turbo™ System

Bioradiations Staff

Step-by-step with the Trans-Blot Turbo system — from building the blot sandwich to programming the run.

The postTrans-Blot^®Turbo™ Systemfirst appeared onBioradiations.]]>

1000-Series Touch Thermal Cyclers

Bioradiations Staff

Touch the future of PCR; introducing the 1000-series Touch thermal cyclers.

The post1000-Series Touch Thermal Cyclersfirst appeared onBioradiations.]]>

2011年最佳计划

Bioradiations Staff

The people behind the science – the reason Bio-Rad has been named one of the "2011 Best Places to Work in the Bay Area" by the San Francisco Business Times.

The post2011年最佳计划first appeared onBioradiations.]]>